Unit 4 Day 8 Translation

Unit 4 Day 8 Translation

By jack morgan

Open Ended

Review: What is the "Central Dogma" of Molecular Genetics?

• ​Transcription occurs in the nucleus, while translation occurs in the Cytoplasm

Now that we're done with transcription, remember its all about LOCATION, LOCATION, LOCATION​

​

• mRNA is "read" by a ribosome, and translated into a protein

• This protein is what goes on to actually express the trait​

​

​

Part 2: Translation​

​

Just like how RNA and DNA are made up of Nucleotides, Proteins are made up of Amino Acids​

​

Each Amino Acid​ corresponds to a 3 Nucleotide, or 3 letter, sequence called a codon

​

Start Codon: AUG- Met or Start

Stop Codons: UAA, UAG, UGA​

​

To understand translation, we must understand the Universal Code​

​

Open Ended

Discuss with your group: Can we determine the function of a protein from a single amino acid? Why or why not?

​

​DNA- TACGCACATTTACGTACGCGG

​

RNA- ​AUGCGUGUAAAUGCAUGCGCC

​

Protein- ​Met Arg Val Asn Ala Cys Ala

How does the information in DNA become Proteins? ​

​

RNA codes for proteins in triplets

This means that 1 amino acid is coded for by 3 nucleotides

​​

​

​

How can only 4 Nucleotides code for 20 amino acids?

​

​

​AUG CGU UUC GAU UGA

​

Met ​ Arg Phe Asp STOP

​

​

​

​an anti-codon is the 3 complimentary bases to the codon we are translating

​

these bases are tRNA​

​

​How are Amino Acids attached to mRNA?

​

ANTI-CODON​

Transfer RNA has a cloverleaf structure​

​

​the anticodon is located on the center "leaf"

​

the amino acid is on the 3' end​

​

Transfer RNA structure

​

​

Open Ended

Discuss with your group: In your own words, explain the difference(s) between mRNA and tRNA

• ​Facilitates the connection of mRNA codons to tRNA anti-codons​

• ​Structure:

  • Ribosomal RNA (rRNA)

  • 2 subunits (one large, one small)​

• Ribosomes are ​very large enzymes, which are also considered organelles

​

​

So where do Ribosomes come in?​

​

​

​Initiation: brings together mRNA and ribosome subunits

Elongation:​ amino acids are chained together based on codons

Termination:​ end codon signals ribosome to detach and release the polypeptide

Building a polypeptide​

​

RNA Recap​

• ​messenger RNA: transfers genetic information from DNA, the working instructions

  • the 'message'

• ​transfer RNA: the "anticodons" which attach to mRNA and add the correct amino acid

  • the 'transporter'

• ribosomal RNA: part of the structure of Ribosomes​

  • the 'reader'

Any Questions before the weekend?​