Mutations - HB

Higher Biology

Mutations Quiz

​Sophies Tutoring Caithness

Multiple Choice

What do we call the light micrograph which shows the X and Y chromosomes of an individual?

• Genome

• Karyotype

• Maryotype

• Typokaryo

Fill in the Blanks

Fill in the Blanks

Fill in the Blanks

Multiple Select

Which of these are single gene mutations (select all that apply)

• Substitution

• Missense

• Deletion

• Insertion

Open Ended

Explain what a substitution mutation is.

Open Ended

Explain what happens during an insertion mutation

Multiple Select

Identify which of the following are point mutations

• Missense

• Nonsense

• Insertion

• Splice site

Dropdown

​

Select answer

mutations occur from a substitution, missense mutations alter the ​

Select answer

of the protein so it cannot carry out its function. ​

Select answer

mutations also occur from a substitution which changes the codon from an amino acid to a ​

Select answer

codon, resulting in a protein being produced. ​

Select answer

site mutations are caused by substitutions which affect the boundaries between exons and introns (splice sites), a mutation here can result in a different protein being made.

Open Ended

Which amino acids will be produced by this DNA sequence?

CATTCACACGTACTCATGCTA

​CATTCACACGTACTCATGCTA

​His - Ser - His - Val - Leu - Met - Leu

​ANSWER

Open Ended

if a substitution mutation occurs to the previous sequence, what amino acids will be produced now?

CATTCACACGTACTCATGCTATGA

​CATTCACACGTACTCATGCTATGA

​His - Ser - Leu - Val - Leu - Met - Leu - Stop

​ANSWER

Multiple Select

Identify the chromosome structure mutations. (Select all that apply)

• Deletion

• Translocation

• Inversion

• Duplication

Dropdown

​ ​

Select answer

is where a section of a chromosome is ​

Select answer

. ​

Select answer

is where a section of a chromosome is ​

Select answer

to another chromosome that is not its ​

Select answer

partner.

Dropdown

​ ​

Select answer

is where a section of a chromosome is ​

Select answer

. ​

Select answer

occurs when a section of a chromsosome is ​

Select answer

from its ​

Select answer

partner.

Fill in the Blanks

Fill in the Blanks