Mutations - HB

Higher Biology

Mutations Quiz

​Sophies Tutoring Caithness

Multiple Choice

What do we call the light micrograph which shows the X and Y chromosomes of an individual?

• Genome

• Karyotype

• Maryotype

• Typokaryo

Fill in the Blanks

A mutation can only be disadvantageous. True or false?

Fill in the Blanks

What are single gene mutations?

Fill in the Blanks

What do we call a mutation that affects the structure of one or more chromosomes?

Multiple Select

Which of these are single gene mutations (select all that apply)

• Substitution

• Missense

• Deletion

• Insertion

Open Ended

Explain what a substitution mutation is.

Open Ended

Explain what happens during an insertion mutation

Multiple Select

Identify which of the following are point mutations

• Missense

• Nonsense

• Insertion

• Splice site

Dropdown

​

Select answer

mutations occur from a substitution, missense mutations alter the ​

Select answer

of the protein so it cannot carry out its function. ​

Select answer

mutations also occur from a substitution which changes the codon from an amino acid to a ​

Select answer

codon, resulting in a protein being produced. ​

Select answer

site mutations are caused by substitutions which affect the boundaries between exons and introns (splice sites), a mutation here can result in a different protein being made.

Open Ended

Which amino acids will be produced by this DNA sequence?

CATTCACACGTACTCATGCTA

​CATTCACACGTACTCATGCTA

​His - Ser - His - Val - Leu - Met - Leu

​ANSWER

Open Ended

if a substitution mutation occurs to the previous sequence, what amino acids will be produced now?

CATTCACACGTACTCATGCTATGA

​CATTCACACGTACTCATGCTATGA

​His - Ser - Leu - Val - Leu - Met - Leu - Stop

​ANSWER

Multiple Select

Identify the chromosome structure mutations. (Select all that apply)

• Deletion

• Translocation

• Inversion

• Duplication

Dropdown

​ ​

Select answer

is where a section of a chromosome is ​

Select answer

. ​

Select answer

is where a section of a chromosome is ​

Select answer

to another chromosome that is not its ​

Select answer

partner.

Dropdown

​ ​

Select answer

is where a section of a chromosome is ​

Select answer

. ​

Select answer

occurs when a section of a chromsosome is ​

Select answer

from its ​

Select answer

partner.

Fill in the Blanks

How much of the genome is made up of regions that code for protein?

Fill in the Blanks

What type of chromosome structure mutation is important for evolution?