3.3.3_Practice EOC_Biotechnology

Which technique would most likely be used by forensic scientists?

• A gene cloning
• B gene therapy
• C DNA fingerprinting
• D karyotyping

Which is one reason scientists produce transgenic organisms?

• A to create new species of organisms
• B to control microorganisms in the soil
• C to prevent habitats from being destroyed
• D to treat certain types of diseases

 A hospital wants to identify. Based on the
DNA fingerprints, which couple is most likely the parents of the baby.  

• Couple W
• Couple Z
• Couple Y
• Couple X

Two people believe they are related. Which would be the best technique to
determine if they are related?

• A testing blood types
• B comparing DNA
• C examining karyotypes
• D testing for genetic disorders

Which is a step in the process of producing transgenic bacteria?

• A A plasmid is used to replace a faulty gene in a human cell.
• B A chain of bacterial amino acids is inserted into human DNA.
• C A human gene is inserted into a bacterial plasmid.
• D A mutation is produced in a bacterial cell.

Restriction Enzyme A reads AGTC and cuts between G and T.  Cut the following DNA:
ACTCAGTCCTCTAAGCCAGTCCTCAAAAGTC
How many fragments are there?

• 1
• 2
• 3
• 4

Using biotechnology to change the genetic makeup of an organism is called

• Tissue Culturing
• Biotechnology
• Cloning
• Genetic Engineering

A cloned pig has a diploid chromosome number of 35. What is the diploid chromosome number of the pig cell that was used to produce the clone? 

• 17.5
• 70
• 35
• 23

Tags

NGSS.HS-LS3-1

Which would be the benefit of a transgenic crop?

• decreased drought tolerance
• decreased disease resistance
• increased resistance to pests
• increased demands for nutrients

Tags

NGSS.HS-LS3-2

Which of the following would be an example of gene therapy technology?

• development of a nasal spray that contains copies of the normal gene that is defective in person with cystic fibrosis
• cutting DNA into fragments with restriction enzymes
• modifying E. coli to produce indigo dye for coloring denim blue jeans
• separation DNA fragments using gel electrophoresis