Gel Electrophoresis

Which DNA fragment bands move faster and farther in a gel electrophoresis? 

• there is no way to tell 
• the largest ones
• the smallest ones
• none of these

Why do the fragments of DNA in gel electrophoresis travel away from the negative electrode?

• DNA is negatively charged so attracted to the positive end of the unit
• DNA is positively charged to attracted to the negative end of the unit
• the agarose gel in negatively charged
• the agarose gel is positively charged

What is the purpose of gel electrophoresis?

• helps cut DNA
• count the genes in DNA
• separates DNA based on size
• allows for an exact replicated organism

Which two bat species are most closely related?

•  Bat 1 and Bat 2
• Bat 1 and Bat 3
• Bat 2 and Bat 3
• There’s no way to tell

Shannon does not know who her father is.  There are three possibilities:  Jack, Daniel and Bill.  Who is the father?

• Jack
• Daniel
• Bill

Restriction Enzyme A reads AGTC and cuts between G and T.  Cut the following DNA:
ACTCAGTCCTCTAAGCCAGTCCTCAAAAGTC
How many fragments are there?

• 1
• 2
• 3
• 4

During gel electrophoresis, DNA moves from the ___ end to the ___ end.

• positive, negative
• negative, positive