DNA Review

Which of the following is NOT true about nuclear DNA?

• It is found in the nucleus of the cell.

• It is inherited only from the father.

• Its form is a double helix.

• Consists of 23 pairs of chromosomes.

Tags

NGSS.HS-LS3-1

How does DNA move through the gel during electrophoresis?

• Water

• Gravity

• Electricity

• Magic

Tags

NGSS.HS-PS2-5

What is the STR in the following sequence of DNA? ATTAACCGCCGCCGCTTCATTAAC

• ATT

• AAC

• CGC

• TTA

Restriction Enzymes

• are a method of separating molecules, such as DNA, according to size.

• are a sequence of repeating bases in noncoding regions of DNA that the FBI use in DNA profiling.

• are "molecular scissors" that cut a DNA molecule at a specific base sequence.

• are a pattern of DNA fragments obtained by analyzing a person's unique sequences of noncoding DNA.

Short Tandem Repeats

• are a sequence of repeating bases in noncoding regions of DNA that the FBI use in DNA profiling.

• is a method of separating molecules, such as DNA, according to size

• are a pattern of DNA fragments obtained by analyzing a person's unique sequences of noncoding DNA.

• are "molecular scissors" that cut a DNA molecule at a specific base sequence.

Tags

NGSS.HS-LS3-2

STRs (short tandem repeats)

• are longer than the bases used by Dr. Alec Jeffreys.

• are easily recovered from limited quantities of DNA.

• repeat more than the original method.

• do not have to be copied.

Polymerase Chain Reation

• is a method of separating molecules, such as DNA, according to size.

• is a sequence of repeating bases in noncoding regions of DNA that the FBI use in DNA profiling.

• are "molecular scissors" that cut a DNA molecule at a specific base sequence.

• is a method of copying small amounts of DNA evidence for use in investigations.

Which cells do not contain DNA?

• Red Blood Cells

• White Blood Cells

• Hair Cells

• Skin Cells

Mitochondrial DNA is

• individual evidence.

• class evidence.

An intron

• is a portion of a gene that is expressed.

• is found in the DNA of human cells.

• is a portion of a gene that is not expressed.

• is the segment of DNA that codes for a trait.