Miller and Levine Spring Biology Final

Mendel was a careful researcher who studied the inheritance of certain traits in garden peas. What are some of the research practices Mendel used?

• He crossed true-breeding pea plants.

• He analyzed his data mathematically.

• He allowed eggs to be fertilized only by self-pollination.

• He controlled variables by studying one or two traits at a time.

Tags

NGSS.HS-LS4-3

Study the Punnett square shown here. It describes the potential offspring of a cross between two parents.

What phenotypes will be shown by the offspring?

• All offspring will show the recessive phenotype for this trait.

• All offspring will show the dominant phenotype for this trait.

• Half of the offspring will show the dominant phenotype and half will show the recessive phenotype.

• Three fourths of the offspring will show the dominant phenotype and one fourth will show the recessive phenotype.

Tags

NGSS.HS-LS3-1

NGSS.HS-LS3-3

A geneticist crossed tall pea plants and obtained 971 tall pea plants and 315 short pea plants in the F₁ generation. What were the genotypes of the parents that produced the offspring in the Punnett square shown, if T is the allele for tall, and t is the allele for short?

• Tt

• TT

• tt

• TtTt

Tags

NGSS.HS-LS3-2

NGSS.HS-LS3-1

Alvin is studying a model of the chemical structure of a common nucleic acid. He observes that the nucleic acid consists of four nitrogenous bases: adenine (A), cytosine (C), guanine (G), and uracil (U). Alvin's observation most strongly supports which of these conclusions?

• The nucleic acid is a form of RNA, and is not DNA.

• The nucleic acid is either mRNA or rRNA, but not tRNA.

• The nucleic acid is either RNA or DNA.

• The nucleic acid is DNA, and is not RNA.

Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below.

AUGCCACAGGUUCAUCCGAA…

To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?

• Calculate the frequencies of each letter.

• Count the number of letters in the list.

• Separate the list into three-letter "words."

• Separate the list into two-, three- and four-letter "words."

A molecule of tRNA includes a sequence of three nitrogenous bases called an anticodon. What is the role of the anticodon in the process of translation?

• The anticodon binds to a codon on rRNA.

• The anticodon binds to a codon on mRNA.

• The anticodon binds to a specific amino acid.

• The anticodon binds to the promoter, a region of DNA.

The diagram illustrates part of the function of the lac operon. It shows the operator region (O) and a protein that is bound to it. The diagram also shows the enzyme RNA polymerase. What is the function of the protein that is bound to the operator region?

• It is a repressor protein that stops transcription from occurring.

• It is an enzyme that will allow transcription to occur.

• It is an enzyme that will break apart the operon into three separate pieces.

• It is lactase, the enzyme that dissolves lactose, and the product of the operon.

Tags

NGSS.HS-LS1-1

Bacteria reproduce ____________ through cell fission. A tube of cytoplasm can temporarily connect two bacterial cells to transfer genetic information.

• asexually

• sexually

Tags

NGSS.MS-LS3-2

Bacteria reproduce asexually through cell fission. A tube of cytoplasm can temporarily connect two bacterial cells to transfer genetic information. Some DNA passes through this tube. Like ____________ reproduction it causes genetic variation. However, it does not produce offspring.

• asexual

• sexual

Tags

NGSS.MS-LS3-2

NGSS.MS-LS4-4

If an organism is successful in a particular environment, ____________ reproduction is ____________.

• sexual, advantageous

• asexual, disadvantageous

• sexual, disadvantageous

• asexual, advantageous

Tags

NGSS.HS-LS4-4