MI 1.1 Online Review 2

Which of the following cannot be determined by an ELISA test?

• Concentration of antigens

• Presence of disease

• Genetic sequence of a pathogen

• Order of infection

What does ELISA stand for?

• E coli Immune System Antigen
• Enzyme-linked Immunosorbent Assay
• Enzyme Leuko-immune Standard Assessment
• Estimated Lymph Integrated System Assessment

Which of the following most definitely identifies a pathogen?

• consensus of symptoms of those affected

• presence of absence of a rash

• response to antibiotics

• DNA sequencing

• none of these

After adding the secondary antibody and enzyme complex to the ELISA, what is added next (after washing) to create the color change?

• substrate

• primary antibody

• enzyme #2

• antigen

A tube is diluted at a rate of 1/4 for each consecutive tube. The concentration of tube #1 is 64ng/dL. What is the concentration of tube #4?

• 4 ng/dL

• 1 ng/dL

• 0.25 ng/dL

• 1024 ng/dL

________ have surface _________ where _______ attach

• pathogens, antigens, antibodies
• antigens, antibodies, pathogens
• pathogens, antibodies, antigens
• antibodies, antigens, pathogens

B lymphocytes respond to the initial antigen challenge by

• reducing its size

• immediately producing antigen-specific antibodies

• forming a large number of cells that are unlike the original B lymphocyte

• producing progeny cells that include plasma cells and memory cells

What is the nucleotide sequence for the following DNA sequencing data? Choose the best answer

• CTTCACGCCAAGTTGTTGTGGGAGGC

• GTTGAGCGGAACTTCTCCCACCG

• GAAGTGCGGTTCAACACCCTCCG

• CAACTCGCCTTGAAGAGGGTGGC

The search tool used to identify pathogens from a sequence of nucleotides is which of the following?

• ELISA

• BLAST

• DNA Sequencing

• PCR

When analyzing your blast results, a high E- value would indicate which of the following?

• the match is likely accurate

• the match is likely inaccurate