Gel electrophoresis

This laboratory procedure is known as

• CLONING

• gel electrophoresis

• chromatography

• use of a dichotomous key

In preparation for an electrophoresis procedure, enzymes are added to DNA in order to

• convert the DNA into gel

• cut the DNA into fragments

• change the color of the DNA

• produce longer sections of DNA

The parents of a new baby believe they brought the wrong child home from the hospital. Gel electrophoresis was performed using DNA samples from the parents and the child. A section of the gel

electrophoresis results is shown below. Which conclusion is valid based on the gel electrophoresis results?

• They have the correct child, because her genetic information is identical to that of the father.

  
  

• They have the wrong child, because her genetic information does not match that of either parent.

• They have the correct child, because her genetic information came from both parents.

  
  

• They have the wrong child, because her genetic information matches only that of the mother.

A student performed a gel electrophoresis experiment. The results are represented in the diagram

below. Compared to the fragments at the top of the gel, the fragments at the lower end are

• larger, and move slower

• larger, and move faster

• smaller, and move faster

• smaller, and move slower

Which chemicals are used to cut DNA into fragments for a gel electrophoresis procedure?

• enzymes

• molecular bases

• hormones

• ATP molecules

This technique used to analyze DNA involves the

• synthesis of new DNA strands from subunits

• separation of DNA fragments based on size

• production of genetically engineered DNA molecules

• removal of defective genes from DNA

Gel electrophoresis is used to separate DNA fragments on the basis of which property?

• size

• color

• functions

• chromosomes

Sample 1: ATTCCGGTAATCCCGTAATGCCGGATAATACTCCGGTAATATC

Sample 2: ATTCCGGTAATCCCGTAATGCCGGATAATACTCCGGTAATATCThe results of DNA analysis are often used to help determine

• the number of DNA molecules in an organism

• if two species are closely related

  
  

• the number of mRNA molecules in DNA

  
  

• if two organisms contain carbohydrate molecules

A student performed a gel electrophoresis experiment. The results are represented in the diagram

below. Compared to the fragments at the top of the gel, the fragments at the lower end are

• larger, and move slower

• larger, and move faster

• smaller, and move faster

• smaller, and move slower

Based on these results whose blood was found in the blood stain at the crime scene?

• Bob
• Sue
• John
• Lisa