Systematic bacteriology for Week 2

Estimate the genomic DNA G+C content of the following:

 

ATTCGTCGGTTTAACTGCAC           

• 32%

• 40%

• 45%

• 50%

Which describes the best for the polyphasic taxonomy?

• consensus approach to bacterial taxonomy by phenotypic classification only

• consensus approach to bacterial taxonomy by genotypic classification only

• to select and identify by selective plates

• consensus approach to bacterial taxonomy by phenotypic and genotypic classification

Which of the following is NOT phenotypic classificatio?

• DNA-DNA hybridisation

• Bacterial capsule staining

• Plating on nutrient agar

• Gram-staining

Which of the following bacteria has curved-rod shaped (comma-shape)?

• Staphylococcus spp.

• Bacillus spp.

• Vibrio spp.

• Fusobacterium spp.

Which is the best description for the morphology of Fusobacterium under the microscope?

• Gram-negative cocci in chains

• Gram positive rod shaped

• Gram negative, long, slender rods with sharply pointed ends

• Gram negative spiral shaped

In the molecular genetic technique of hybridization of DNA, single strands of DNA from two different species are allowed to join together to form hybrid double helices. This refers to

• G+C content

• DNA fingerprinting

• 16S rRNA sequencing

• DNA-DNA hybridisation

Which of the following is NOT the limitation of phenotypic classification?

• Limited number of visible traits does not afford unique descriptions for each of the millions prokaryotes

• Such characteristics are not necessarily correlated with the evolutionary relationships of prokaryotes

• Phenetic classification of prokaryotes may have different degrees of reproducibility and comparability of results obtained by different laboratories

• starting points for further characterization