DNA Analysis Forensic Science

The four types of nucleotides that make up DNA are named for their:

• hydrogen bonds
• nitrogenous bases
• phosphate group
• ring-shaped sugars

Which model of base pairing is correct?

• A=T and C=G
• A=T=C=G
• A+T and G+C
• A=G and T=C

If base-pairing rules state that Adenine always pairs with Thymine, and Cytosine pairs with Guanine, what would be the complementary strand to ACGGT?

• ACGGT
• TGGCA
• TGCCA
• ACCGT

Is a purine a single-ring structure or a double-ring structure?

• single
• double

Which nucleotides are considered purines?

• Adenine & Thymine
• Cytosine & Guanine
• Adenine & Guanine
• Cytosine & Thymine

You load some DNA into a gel with the following Restriction Fragment Length Polymorphism lengths—25bp, 13bp, 54bp, and 11bp. Which of these four would travel the greatest distance from the well during electrophoresis?

• 25bp
• 13bp
• 54bp
• 11bp

The purpose of PCR

• cutting DNA
• creating RFLPs
• amplifying/copy DNA
• reversing the charge of DNA

A restriction enzyme cuts DNA at
CC/GG
GG/CC
ATCGAATTGGCCGAAATTTCCGGAT
TAGCTTAACCGGCTTTAAAGGCCTA
The number of RFLPs or fragments that would result.

• 3
• 2
• 5
• 4

Put the following in order from 1st step to last step.
A. Stain the gel
B. PCR
C. Load the DNA
D. Analyze
E. Add restriction enzymes
F. Electrophorese

• B, E, C, F, A, D
• D, A, C, B, F, E
• F, C, A, E, B, D
• B, C, E, A, D, F

How many of these restriction enzymes produce sticky ends?

• 2
• 4
• 5
• 3