DNA Quiz

What do the letters DNA stand for?

• Deoxyribonucleic Acid

• Deoxyribose Nucleic Acid

• Dioxyribonucleic Acid

• Deoxyribonucleic Alkaline

What are the monomers in DNA called?

• Nucleotides

• Amino Acids

• Proteins

• Lipids

The backbone of the DNA molecule is made up of two components. What are these?

• Sugar and Phosphate

• Sugar and Protein

• Phosphate and Lipid

• Protein and Lipid

What are the four different bases in DNA?

• Adenine, Thymine, Cytosine, Guanine

• Adenine, Uracil, Cytosine, Guanine

• Thymine, Uracil, Cytosine, Guanine

• Adenine, Thymine, Uracil, Guanine

Which base pairs with Adenine in DNA?

• Thymine

• Cytosine

• Guanine

• Uracil

Which base pairs with Cytosine in DNA?

• Guanine

• Thymine

• Adenine

• Uracil

What is the shape of a DNA molecule called?

• Double Helix

• Single Helix

• Triple Helix

• Quadruple Helix

What enzyme begins the replication of DNA by breaking the complementary base pairs?

• Helicase

• Polymerase

• Ligase

• Primase

What is the complementary DNA sequence to the strand AATTCGCGGGTATTAGACGT?

• TTAAGCGCCCATATCTGCAC

• TTAAGCGCCATAATCTGCA

• TTAAGCGCCGATAATCTGCA

• TTAAGCGCCGTAATCTGCA

What is the function of the enzyme helicase in DNA replication?

• Breaks the complementary base pairs

• Joins the DNA fragments

• Synthesizes new DNA strands

• Repairs DNA damage