DNA Structure, Replication, and Protein Synthesis Study Guide

The first 3D model of DNA was made by which scientists?

• James Watson and Francis Crick

• Albert Einstein and Niels Bohr

• Marie Curie and Pierre Curie

• Isaac Newton and Galileo Galilei

The scientist who made an x-ray crystallography of DNA was?

• Rosalind Franklin

• Marie Curie

• Albert Einstein

• Isaac Newton

The structure of DNA can be defined as a _____________.

• a double helix

• a single strand

• a triple helix

• a quadruple helix

DNA is formed by repeating units called _________________ .

• nucleotides

• amino acids

• lipids

• carbohydrates

The 5 carbon sugar of DNA is _______________.

• deoxyribose

• ribose

• glucose

• fructose

In DNA, the two strands of DNA are parallel to each other, but run in opposite directions, the term to describe this is _______________.

• antiparallel

• parallel

• co-directional

• unidirectional

Each nucleotide is composed of 3 components:

• a. Phosphate group, Sugar (deoxyribose or ribose), Nitrogenous base

• b. Phosphate group, Sugar (deoxyribose or ribose), Amino acid

• c. Phosphate group, Lipid, Nitrogenous base

• d. Phosphate group, Sugar (deoxyribose or ribose), Fatty acid

Challenge question: Chargaff is given credit for the base pairing rules. These rules are that A always pairs with T and C always pairs with G. Because of this rule, we can determine the % of each nitrogenous base. For example: If there is 12% cytosine, how much thymine is in the DNA sample?

• 12%

• 38%

• 76%

• 24%

Complete the complementary Base Pair to this DNA strand below by making a new DNA strand. 3’ATGTTAATTGTGAATGTACCGTATGGTA5’

• 3’TACAATTAACACTTACATGGCATACC5’

• 3’TACAATTAACACTTACATGGCATACC3’

• 5’TACAATTAACACTTACATGGCATACC3’

• 5’TACAATTAACACTTACATGGCATACC5’

The accepted theory of DNA replication that indicates that each molecule of DNA consists of one old strand and one new strand is __________ replication.

• semi-conservative

• conservative

• dispersive

• random