Quiz_section 025

You discover a new organism that appears to store its genetic information as DNA, has cytosol, and has a plasma membrane, among other things. After further analysis, you find that the organism uses polycistronic mechanisms. What can you conclude for a fact based on the information given here?

• The organism is a prokaryote
• The organism encodes multiple genes using a single transcript
• The organism encodes multiple transcripts using a single gene
• The organism is compartmentalized
• N/A

The reference sequence for part of the human genome is given below: ACGCTAGCTGACAGCTGTGATCGTAGCTGACCGTACCTGATCGTAGCT The following is a sequence from an individual's genome: GTGATCGTAGCTGACCGTACCTGATCGTAGCTACGCTAGCTGACAGCT What type of mutation explains the difference between the two genomes?

• Deletion
• Transition
• Transversion
• Translocation
• Substitution

Why is hunchback (HB) mRNA not translated in the posterior part of the Drosophila embryo?

• A) Nanos protein breaks down HB mRNA in the posterior region.
• B) Nanos protein forms a complex with Pumilio, which binds to the Nanos Response Element (NRE) on HB mRNA, preventing translation.
• C) HB mRNA in the posterior region does not have a poly-A tail, so ribosomes cannot bind.
• D) HB mRNA is spliced differently in the posterior region, making a non-coding version.
• Empty

A pre-mRNA transcript undergoes alternative splicing, producing two distinct mature mRNA isoforms. In one isoform, a specific exon is retained, while in the other, a different exon is incorporated. This occurs at the same genomic locus which ensures that the two exons are never co-expressed within the same transcript. Which of the following mechanisms does this type of alternative splicing most accurately exemplify?

• A) Alternative 5’ splice site
• B) Mutually exclusive exon inclusion
• C) Alternative polyadenylation
• D) Exon skipping (exon inclusion/exclusion)
• E) Alternative 3’ splice site

In a genetic screen for yeast mutants that cannot synthesize leucine, 100 mutant strains were isolated. A complementation test was performed by mating the mutants in pairs, and the results showed three distinct complementation groups. What does this indicate?

• The mutants belong to six different genes responsible for leucine synthesis.
• The mutants belong to three different genes responsible for leucine synthesis.
• All the mutants have mutations in the same gene.
• The mutants have 3 distinct mutations in the same gene responsible for leucine synthesis.
• This doesn't mean anything, and the genome cannot be analyzed further.