NEW
Font size
WorksheetsAnalisis Filogenetik 2 2019
Total questions: 10
Worksheet time: 8mins
The DNA sequence of a template is "5'ATGAGTTCTGGGAAGAGACACTCGCAG3' ", the reverse complement will be…
5'ATGAGTTCTGGGAAGAGACACTCGCAG3’
5' GACGCTCACAGAGAAGGGTCTTGAGTA3'
5'CTGCGAGTGTCTCTTCCCAGAACTCAT3'
5’TACTCAAGACCCTTCTCTGTGAGCGTC3’
In a chromatogram file with .ab1 format, the signal intensities of nucleotides are presented in a graph or peak with the four bases: Adenine (A), Thymine (T), Guanine (G), Cytosine (C), identified by different colors. The colors are..
Blue for A, red for T, black for G, and green for C
Green for A, red for T, black for G, and blue for C
Blue for A, black for T, green for G, and red for C
Black for A, blue for T, green for G, and red for C
Current technology allows for the direct sequencing of only relatively short DNA fragments (300–1000 nucleotides), genomic DNA must be fragmented into small pieces prior to sequencing. A continuous sequence resulting from the reassembly of the small DNA fragments is called …
Complement sequence
Paired sequence
Contig sequence
Consensus sequence
Phylogeny is the studi of the evolutionary history of living organisms using tree-like diagrams to represent pedigree of these organisms. The tree branching patterns representing the evolutionary divergence are referred to as phylogenetic.
True
False
MrBayes is one of the phylogenetic methods. Here are some things about MrBayes, except..
character-based phylogenetic analysis
using FASTA format file
development of maximum likelihood evolutionary method
can produce hundreds or thousands of optimal trees and faster than regular maximum likelihood method
Bayesian analysis calculate probability of two joint events by using the prior probability and conditional probability values. In Bayesian tree selection, the conditional probability is the substitutions frequency of characters observed from the sequence alignment before tree constructed. The prior probability is the probability for all possible topologies before analysis.
True
False
Bayesian analysis using the following formula...
total probability = prior probability * posterior probability / conditional likelihood
prior probability = posterior probability * conditional likelihood / total probability
posterior probability = total probability * prior probability / conditional likelihood
posterior probability = prior probability * conditional likelihood / total probability
Multiple substitutions and divergence at individual position obscure the estimation of the true evolutionary distance between sequences. A simple measure of the divergence between two sequences is to count the number of substitutions in an alignment. The unused model to measure the substitutions is..
Jukes-Cantor
PROSITE
PAM
Kimura
Samples tree topologies of MrBayes using the (MCMC) Markov Chain Monte Carlo procedure and infers the posterior distribution of tree topologies.
True
False
Samples tree topologies of MrBayes using the (MCMC) Markov Chain Monte Carlo procedure. MCMC is designed to..
test the sampling errors of a phylogenetic tree
direct high-scoring trees are sampled less often than low-scoring trees
seeking higher likelihood scores while searching for tree topologies
delete one half of the sites in a dataset
