NEW
Font size
WorksheetsMI 1.1 Online Review 2
Total questions: 10
Worksheet time: 5mins
Which of the following cannot be determined by an ELISA test?
Concentration of antigens
Presence of disease
Genetic sequence of a pathogen
Order of infection
Which of the following most definitely identifies a pathogen?
consensus of symptoms of those affected
presence of absence of a rash
response to antibiotics
DNA sequencing
none of these
After adding the secondary antibody and enzyme complex to the ELISA, what is added next (after washing) to create the color change?
substrate
primary antibody
enzyme #2
antigen
A tube is diluted at a rate of 1/4 for each consecutive tube. The concentration of tube #1 is 64ng/dL. What is the concentration of tube #4?
4 ng/dL
1 ng/dL
0.25 ng/dL
1024 ng/dL
B lymphocytes respond to the initial antigen challenge by
reducing its size
immediately producing antigen-specific antibodies
forming a large number of cells that are unlike the original B lymphocyte
producing progeny cells that include plasma cells and memory cells
What is the nucleotide sequence for the following DNA sequencing data? Choose the best answer
CTTCACGCCAAGTTGTTGTGGGAGGC
GTTGAGCGGAACTTCTCCCACCG
GAAGTGCGGTTCAACACCCTCCG
CAACTCGCCTTGAAGAGGGTGGC
The search tool used to identify pathogens from a sequence of nucleotides is which of the following?
ELISA
BLAST
DNA Sequencing
PCR
When analyzing your blast results, a high E- value would indicate which of the following?
the match is likely accurate
the match is likely inaccurate
