Font size
WorksheetsUnit 6 - Evolution Test
Total questions: 21
Worksheet time: 52mins
A population of bacteria is treated with hand sanitizer. Because of genetic variation in the population, what is a possible outcome?
The population will grow quickly
All of the bacteria are already resistant
They will get better at obtaining a food source
Some may be resistant and survive
Genes for traits that help an organism be more successful reproductively can be expected to
cause it to evolve into a new species
become more common in the future
cause the extinction of the species
eventually be eliminated by natural selection
An insecticide kills most of the ants on a plant. Over time, it is determined that the insecticide is not as effective for killing ants. Which statement BEST explains this observation?
The ants killed initially by the insecticide were genetically the same as the surviving ants
The ants killed initially by the insecticide had thinner cell membranes than the surviving ants
The ants that survived were younger than those that died as a result of the insecticide
The ants killed by the insecticide and the surviving ants were genetically different
Which statement BEST describes natural selection?
As the weather changes, organisms that are able to find shelter need less energy to live
Organisms that eat only plants need less food than organisms that eat animals
Organisms better adapted to their environment are more likely to reproduce and pass on their traits to their offspring
Small organisms are more likely to survive than larger organisms
During a period of droughts in the Mojave Desert, seeds that are small and easily eaten become more and more rare, leaving mostly seeds that are large with hard-cased shells behind. The only birds that can eat these particular seeds are those with large beaks. If the drought continues for several more years, what should be expected to happen as a result of natural selection?
Small birds will gain larger beaks by exercising their mouths more
More small-beaked birds will die than larger-beaked birds. The offspring produced in the following generations will have a higher percentage of birds with larger beaks.
Smaller birds will mutate their beak genes, resulting in the following generations having a higher percentage of birds with larger beaks
Small birds will eat more to gain weight in preparation for the drought. As a result, they will grow larger beaks from eating more
Male peafowl, called peacocks, have long, colorful tail feathers. Among peacocks their is variation in the size, brightness, and pattern of the tail. Scientists observed the mating success of two groups of peacocks and the graph shows the scientists' data.
a. Explain what the graph shows about the advantage of longer, more colorful tails for peacocks. (1 point)
b. Identify 1 disadvantage that longer, more colorful tails may have for peacocks. (1 point)
c. Explain how you think the longer, more colorful tails evolved in peacocks despite causing disadvantages for the males, based on what we've learned about evolution (2 points)
Give a BRIEF description of the 3 types of selection (stabilizing, directional, and disruptive). For example, which extreme form of a trait is being favored or is the average being favored? (3 points)
Scientists believe that the polar bear in Alaska and the brown bear in Russia evolved from a common ancestor. Which would be responsible for this evolutionary change?
Artificial selection
Asexual reproduction
Sexual competition
Geographic isolation
Which pattern of evolution results in one species splitting into many over time?
Coevolution
Divergent evolution
Convergent evolution
Sexual selection
Match the vocabulary terms with the correct descriptions from the image. Your answer should be the letters with the definition that matches.(3 points)
1. Gradualism
2. Speciation
3. Punctuated equilibrium
4. Divergent evolution
5. Convergent evolution
6. Coevolution
If scientists wanted to learn more about evolution by studying biochemistry, they would study all of the following EXCEPT
DNA
Proteins
Nucleic acids
Lipids (fats)
In the table, the DNA found in 5 primate species was compared to the DNA found in humans. The number of sequence differences was recorded. Based on the data in the table, what inference could you make about these species compared to humans?
Lemurs are most like humans
Gorillas are most like humans
None of the species are similar to humans
Only the lemur differs from humans in any way.
Scientists can explore whether 2 different animal species have evolved from a common ancestor, using evidence from all of the sources below EXCEPT
sequences of DNA and proteins
embryos of different species
comparison of the experiences of each organism
fossils compared to living species
Which of the following sequences shows the correct hierarchy of classification, going from the BROADEST to the MOST SPECIFIC
Kingdom, Domain, Phylum, Order, Class, Family, Genus, Species
Domain, Kingdom, Phylum, Class, Order, Family, Genus, Species
Genus, Species, Kingdom, Phylum, Order, Class, Family, Domain
Domain, Phylum, Kingdom, Genus, Species, Family, Order, Class
According to binomial nomenclature, species are given 2 names based on their
Kingdom and species
genus and species
Class and phylum
Order and genus
According to the phylogenetic tree
An ancestor of Eubacteria gave rise to all of life on Earth
Archaebacteria came from Eubacteria
Animals gave rise to plants and fungi
Eubacteria and archaebacteria have no common ancestor
Which one of these organisms in the picture is most closely related to the organism on the far left?
A. Curculio nimbusa
B. Diapres brevius
C. Harmonia yelloritus
D. Lixus scrobicollis
If a cell has 8 chromosomes, how many chromosomes will each of its daughter cells have after MITOSIS?
4
6
8
16
If a cell has 8 chromosomes, how many will each of its daughter cells have after MEIOSIS?
4
6
8
16
If available, the body will always digest which macromolecule for energy FIRST?
Lipids
Proteins
Enzymes
Carbohydrates
TRANSCRIBE & TRANSLATE the following DNA sequence using the Codon chart (3 points)
DNA: TACAAACACTTATTCATAACT
* HInt: You can't read the Codon chart with the strand you are given (No T in the chart) and your answer will be and amino acid sequence
