NEW
Font size
WorksheetsTranscription in Prokaryotes
Total questions: 10
Worksheet time: 7mins
How does coupling of transcription and translation in prokaryotes differ from eukaryotes?
In prokaryotes, transcription and translation occur simultaneously in the same cellular compartment
In prokaryotes, transcription and translation occur in separate cellular compartments
In prokaryotes, multiple rounds of transcription must be completed before translation begins
In prokaryotes, translation begins only after the transcription termination
Which subunit of prokaryotic RNA polymerase is responsible for promoter recognition?
β subunit
ω (omega) subunit
σ (sigma) subunit
α subunit
What does the following strand represent?
3' TGCATGCCTACGATTTAAGGCGTGAC 5'
DNA Coding Strand
Template Strand
mRNA starnd
Non-template strand
Which of the following describes the consensus sequence of the -10 box (Pribnow box)
in prokaryotic promoters?
AATAAA
TACAAT
TTGACA
TATAAT
What is the primary function of the NusA protein in prokaryotic transcription?
It catalyzes the addition of nucleotides to the RNA chain
It recognizes promoter sequences
It enhances termination at intrinsic terminators
It prevents backtracking of RNA polymerase
Which element defines the exact starting point of transcription in a prokaryotic promoter?
The -10 box (Pribnow box)
The -35 box
The transcription factor binding site
The +1 site
What happens to the sigma (σ) factor during the transition from initiation to elongation
in prokaryotic transcription?
It remains bound to RNA polymerase throughout transcription
It dissociates from the core enzyme
It is degraded by cellular proteases
It changes conformation to facilitate elongation
What is the UP element in a prokaryotic promoter?
A sequence downstream of the transcription start site
A sequence upstream of the -35 element that binds the α subunit of RNA polymerase
A sequence between the -10 and -35 elements
A sequence involved in termination
What advantage does the coupling of transcription and translation in prokaryotes provide?
It provides immediate production of proteins and efficient resource utilization
It increases the accuracy of protein synthesis
It prevents the formation of RNA secondary structures
It allows for more complex gene regulation
Which of the following is NOT involved in intrinsic (rho-independent) termination
of transcription in prokaryotes?
ATP hydrolysis
Palindromic sequence that forms a hairpin in the RNA
Destabilization of the RNA-DNA hybrid
A series of U residues in the RNA transcript
