WorksheetsBio Final
Total questions: 50
Worksheet time: 25mins
If 35% of an organism’s DNA is thymine, what is the percentage of guanine?
70%
30%
35%
15%
Chargaff’s rules of base pairing are explained by which structural feature of DNA?
Each strand of DNA contains a phosphate and sugar backbone.
DNA is double stranded, and covalent bonds between identical nucleotides hold the strands together.
DNA is double stranded, and hydrogen bonds between base pairs hold the strands together.
The nucleotides of DNA may appear in a wide variety of sequences.
What would happen if a cell divides before DNA replication is completed?
Daughter cells would receive incomplete genetic information, but would regain lost information in the S phase.
Daughter cells would receive incomplete genetic information and never regain it, and they may not survive.
Daughter cells would contain all genes of the parent cell, but would not function normally.
Daughter cells would receive incomplete genetic information, but would regain lost information in the G1 phase.
The sequence of nitrogenous bases on a portion of a strand of DNA is shown in the diagram. From left to right, what is the corresponding sequence of the complementary strand?
TTAGATC
GGTGACT
GGUGTAT
CCACTGA
Which of the following statements describe properties of the DNA molecule that are consistent with Chargaff's data? Select all of the answers that apply.
Two adenine bases on opposite strands can form hydrogen bonds between them.
The hydrogen bonds between opposite strands are very strong, and breaking them causes permanent damage to the molecule.
On a single strand, the four bases are repeated many times and in different combinations.
An adenine base and a thymine base on opposite strands can form hydrogen bonds between them.
On a single strand, the four bases are repeated many times but are always grouped together.
Alvin is studying a model of the chemical structure of a common nucleic acid. He observes that the nucleic acid consists of four nitrogenous bases: adenine (A), cytosine (C), guanine (G), and uracil (U). Alvin's observation most strongly supports which of these conclusions?
The nucleic acid is either mRNA or rRNA, but not tRNA.
The nucleic acid is DNA, and is not RNA.
The nucleic acid is a form of RNA, and is not DNA.
The nucleic acid is either RNA or DNA.
Which type or types of RNA contain a copy of the instructions that a gene carries?
mRNA only
mRNA, rRNA, and tRNA
rRNA only
mRNA and tRNA
Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below. AUGCCACAGGGUUCAUCCGAA… To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?
Count the number of letters in the list.
Separate the list into two-, three- and four-letter "words."
Calculate the frequencies of each letter.
Separate the list into three-letter "words."
A point mutation changes a codon in an mRNA molecule. Will the mutation affect the polypeptide that forms? Why?
No. The structure of DNA, and not RNA, determines the polypeptide.
Maybe. Some pairs of codons are translated into the same amino acid.
Maybe. Some codons are translated into two or more amino acids.
Yes. Each amino acid is specified by only one codon.
Frieda is studying an example of a human karyotype. She makes the following claim about the karyotype. "I can determine which sex chromosome was donated by the male parent, and which sex chromosome was donated by the female parent." Frieda's claim is accurate under which of these conditions?
The karyotype was taken from a newborn baby.
The karyotype was taken from a male.
The karyotype was taken from a female.
The karyotype includes three copies of an autosome.
A scientist has divided a DNA molecule into several fragments. Next, the scientist would use gel electrophoresis to accomplish which task?
identifying the fragments that end in specific nucleotide sequences
separating the fragments by size
separating the fragments into two groups, based on electric charge
cutting the fragments into smaller pieces at specific locations
A genetic disorder is caused by an allele of a sex-linked gene, located on the Y chromosome. How is the disorder inherited?
from either parent to a son only
only from the mother to a son
only from the father to a son
only from the father, to either a son or daughter
Horace is using a computer model to study the relationship between the genes and phenotype of an individual. In one experiment, Horace alters the nucleotide sequence in one of the model genes. In response, the computer shows that the eye color of the individual changes from brown to blue. How did the change in the gene cause the change in phenotype?
by directing the cell to produce a carbohydrate instead of a protein
by altering the number of chromosomes in the cell
by affecting the amino acid sequence of a protein
by affecting the arrangement of glucose molecules in a carbohydrate
Lucille has her personal genome analyzed. The report states that her genome includes one copy of the defective allele that causes cystic fibrosis, an autosomal recessive disease. Lucille is surprised by the report, because she is unaware of the disease in her family history, and she shows no symptoms of it. Lucille asks a genetic counselor if her future children are at risk for suffering the serious symptoms of cystic fibrosis.
A future child has a 25 percent chance of suffering from cystic fibrosis.
A future child has a 50 percent chance of suffering from cystic fibrosis.
A future child might suffer from cystic fibrosis if the father's genetic report is the same as Lucille's report.
A future child has no risk of suffering from cystic fibrosis.
Mrs. Jorgensen keeps a flock of chickens in her back yard. One of the roosters is the result of selective breeding by Mrs. Jorgensen. The rooster is especially tall and muscular, and it has especially thick and colorful feathers. Which event involving the rooster's parents is MOST LIKELY to have occurred?
Mrs. Jorgensen selected both of the rooster's parents, based on their body traits.
Mrs. Jorgensen allowed the rooster's male parent to select the female parent.
Mrs. Jorgensen selected a high-energy, protein-rich food to feed the chickens.
Mrs. Jorgensen removed all but one egg from the clutch that produced the rooster.
Luther Burbank bred potatoes that combined a variety of useful traits. One of Burbank's breeding techniques was hybridization. Which cross of potato plants would have been MOST USEFUL for producing a useful strain by hybridization?
a plant that is not disease resistant crossed with a plant that produces a low volume of food
a disease-resistant plant crossed with a plant that produced a high volume of food
a disease-resistant plant crossed with a plant that is not disease resistant
a disease-resistant plant crossed with a plant that produced a low volume of food
A team of scientists is studying the genome of the pine tree. They have identified a gene that produces a protein that is specific to pine trees. Accomplishing which of the following tasks would require the scientists to incorporate the gene into recombinant DNA?
making multiple copies of the section of DNA that contains the gene
identifying the transcription factors that control the expression of the gene
identifying the sequence of nucleotides in the gene
engineering bacteria to use the gene to produce the pine tree protein
Researchers are investigating the use of gene therapy as a treatment option for human genetic disorders, such as cystic fibrosis. When gene therapy is successful, how does it treat the disorder?
by activating, or "turning on," one or more genes
by incorporating a human gene into the genomes of bacteria or other organisms
by replacing a faulty gene with a normal gene in the human genome
by deactivating, or "turning off," one or more genes
Kathy donates a sample of her DNA for scientific analysis. Can the analysis reveal private information about her? Why or why not?
Yes. It can determine her approximate age, height, and weight.
Yes. It can reveal ethnic heritage, the presence of certain diseases, and evidence for criminal cases.
No. It can only reveal her gender, as well as chromosomal disorders such as Down syndrome.
No. It can only reveal a sequence of nucleotides and the presence of certain genes.
Scientists before Darwin had proposed that living things could change over time. Why was Darwin's theory of evolution more powerful and useful than the proposals of the other scientists?
Darwin explained the mechanism by which evolution occurred.
Darwin hypothesized that evidence from DNA and genes would explain how evolution occurred.
Darwin cited examples from nature that were based on observations.
Darwin used logical reasoning to argue that living things could change over time.
A variety of plants and animals live in a meadow ecosystem. According to Darwin's ideas about evolution, which of these meadow organisms has the greatest fitness?
a lone tree that grows in the middle of the meadow
a snake that eats many mice, and then is eaten by a hawk
a female mouse that has many offspring
a large, healthy hawk that does not find a mate
The wings of ostriches are examples of vestigial structures. The wings provide evidence for which of these evolutionary relationships?
An ancestor of ostriches had vestigial structures.
An ancestor of ostriches had useful wings.
A new bird species without wings will evolve from ostriches.
A new bird species that has useful wings will evolve from ostriches.
A population of male and female goats is stranded on a large island. The goats differ from one another in several ways, including fur color, ear shape, and preferred food. A scientist predicts that the average ear shape of the goats will change gradually over time. According to Darwin's ideas about evolution and natural selection, the accuracy of the prediction depends on which of these conditions?
Certain ear shapes allow the goats to hear a wider variety of sounds.
Certain ear shapes help the goats survive and reproduce on the island.
The island provides enough food to support an increase in the goat population.
The island lacks natural predators of goats.
Giraffes, camels, and horses share some traits, although they vary in other traits. Which statement accurately describes the evolution of these species?
All three species evolved from three unrelated ancient ancestors.
Each species descended from an ancient common ancestor.
Two of the species descended from the other species.
Each species evolved uniquely, without any ancestors.
Which is an example of binomial nomenclature in the Linnaean system of taxonomy?
Longhorn beetle
Felis catus
phylum Chordata, class Aves
Kingdom Fungi
In the Linnaean system of classification, camels are members of the order Artiodactyla and the family Camelidae. Llamas are also members of the family Camelidae. Based on this information, are llamas members of the order Artiodactyla?
Maybe, because some but not all family members are classified in the same order.
Maybe, because families and orders are separate and unrelated taxa.
Yes, because all family members are classified together in the same order.
No, because every family member is classified into a different order.
Scientists now classify all living things into 6 kingdoms. Which of the following groups of organisms is classified into the greatest number of kingdoms?
humans and other multicellular organisms that are about the same size as humans
organisms that are microscopically small and each made of a single cell
plants and animals that are smaller than humans but still visible
multicellular animals that are larger than humans
The domain is a relatively new taxonomic category. Which statement best explains why scientists added the domain to the Linnaean classification system?
Prokaryotic cells are much smaller than eukaryotic cells.
The two groups of prokaryotes differ greatly from each other and from eukaryotes.
A prokaryotic cell lacks a nucleus, while a eukaryotic cell has a nucleus.
All prokaryotes are single celled, while many eukaryotes are multicellular.
Scientists now use domain Eukarya to group together the kingdoms of eukaryotic species, which include plants, animals, protists, and fungi. Which statement about the evolution of eukaryotes supports the grouping of the kingdoms into domain Eukarya?
a. All eukaryotic species descended from a common eukaryotic ancestor.
b. Each eukaryotic kingdom descended from a unique prokaryotic ancestor.
c. Protists evolved first, then the fungi appeared, and then plants and animals.
d. Species in the four eukaryotic kingdoms evolved independently of one another.
Health care professionals are seeing increased instances of bacterial infections that do not respond to standard treatments. The infections are caused by bacterial “superbugs” that cannot be killed by standard means. Which of the following has led to this development?
inadequate hygiene practices
overuse of antibiotics
ineffective use of disinfectants
underuse of vaccines
Fungi have chitin in their cell walls. This is an indication that fungi are most closely related to which group of organisms?
plants
animals
green algae
prokaryotes
While examining a sample of water under the microscope, Laura noticed two bacteria that appeared to be attached by a narrow tube. What is Laura observing?
One bacterium is about to engulf and consume the other.
The bacteria are in the process of conjugation.
One bacterium is forming an endospore, and then the other will do so.
The bacteria are undergoing binary fission.
A cell is infected by a virus, which injects its DNA into the host cell. The cell then produces messenger RNA (mRNA) from the viral genes. The mRNA produces proteins that destroy the host cell’s DNA and turns the cell’s molecular machinery to the job of making viral DNA and capsids. What is the name of this process?
bacteriophage infection
a lytic infection
a prophage infection
a lysogenic infection
As plants have evolved, the diploid, or _____, phase of the plant life cycle has increased in size.
diplophyte
bryophyte
gametophyte
sporophyte
What is the name of the structure that produces sperm in mosses?
archegonium
antheridium
stamen
anther
What factor limits the size of bryophytes?
They do not have vascular tissue, so they cannot move water against gravity.
They grow in places where there is little oxygen, so they are adapted to be small.
They have a broad network of roots and leaf structures, so they spread wide.
They do not have seeds that can travel, so the plants cannot grow large.
Which of the following do ferns lack?
leaves
roots
true seeds
vascular tissues
Many plants make seeds in berries. What advantage does the berry provide?
The berry fertilizes the germinated seed.
The berry entices animals to disperse the seed.
The berry nourishes the seed so that it germinates.
The berry provides insulation for the seed.
In which structure of the plant does gas exchange occur most frequently?
tap roots
flowers
stems
leaves
What is the primary function of ground tissue?
It produces and stores sugars.
It appears both above and below the ground.
It transports water and nutrients.
It produces and transports sugars.
Root systems are classified as fibrous root systems and taproot systems. Which property distinguishes the two types of root systems from each other?
the branching pattern of the roots
the method of water absorption
the growth rate of the roots
the presence of xylem and phloem
Which of the following groups include the world’s five major food crops?
corn, rice, soybeans, potatoes, carrots
hay, rice, corn, soybeans, wheat
barley, corn, soybeans, hay, rice
peas, barley, rice, corn, wheat
A variety of microorganisms live as symbionts in the human digestive tract. What determines whether their relationship with the human is parasitic or mutualistic?
whether their actions harm or benefit the human host
whether or not they gain energy from food that the human eats
their reproductive rate compared to the replication rate of human cells
their size compared to human cells
Which property of an animal's mouth most strongly indicates whether the animal is a carnivore or a herbivore?
the chemical composition of the teeth
the size of the mouth
the shape of teeth, such as sharp or flat tops
the symmetry of the teeth and other mouthparts
Food digestion occurs in much the same way in all vertebrates and many invertebrates. Which describes this common process?
Food is broken down in a digestive cavity, and then nutrients are absorbed.
Food is gradually broken down into smaller pieces as it travels through the blood.
Food is broken down completely in the mouth, and then nutrients are carried to cells.
Food is broken down and combined with oxygen in a digestive cavity, where all metabolism occurs.
Which statement describes how the function of the lungs relates to the function of another organ system?
The lungs depend on the circulatory system to transport carbon dioxide from cells and oxygen to cells.
The lungs depend on the muscular system to actively pump carbon dioxide and oxygen across blood membranes.
The lungs depend on the skin (integumentary system) to allow gases to diffuse in and out of the body.
The lungs depend on the digestive system to release carbon dioxide and transport oxygen.
What is the most significant cause of cell differentiation in a multicellular organism?
differences in gene regulation and gene expression among the cells
differences in the genetic code used by different cells
differences in the number of chromosomes per cell
differences in the DNA that is copied and distributed among the cells
A scientist is studying a single celled organism found in a hot spring. The organism lacks a nucleus and has no peptidoglycan in its cell wall. The organism uses hydrogen sulfide as an energy source, and can survive, even when oxygen is not available.
The organisms mode of nutrition is best described as
Chemoautotrophic
hetertrophic
photohetertrophic
photoautotrophic
Conifers can produce two types of cones. What are the names of the types of cones?
stamen cones and anther cones
soft cones and scale cones
Pollen cones and seed cones
angiocones and gymnocones
which feature is found in an open circulatory system, but never in a closed circulatory system?
Blood in a single loop between a heart, respiratory organ, and body capillaries
sinuses where body tissues are bathed in blood
Blood in a double loop between a heart, respiratory organ, and body capillaries
multiple hearts that pump blood through the system
