Willowridge Genetic Mutations

Willowridge Genetic Mutations and Trascription and translation practice

Human mutations

Cojoined Twins Abby and Brittany

Human Genetic Mutations

Types of Mutations

Human Genetic mutations

The family which walks on Fours

Try a point mutation with your name

Change the 3 letter of your name to an "R" (If it is an R already then you have a silent mutation so change the 3 letter for an "F") can you still read your name or does it make it very weird?

Example:

John Smith to JohR Smith

Using your name again

Stop spelling your name after the 2nd letter of your first name, can most people still know what the name is?

Let's mutate your name more

Deletion mutation. Write our your first and last name in one complete word example : JohnSmith

Now divide your name into "codons" Joh nSm ith

Now remove the 3rd letter and frame shift your name

Example Jon Smi th

Does your name make sense?

Insertion Mutation

Insertion mutation. Write our your first and last name in one complete word example : JohnSmith

Now divide your name into "codons" Joh nSm ith

Now ADD a "R" after the 3rd letter and frame shift your name

Example Joh RnS mit h

Does your name make sense?

Practice Transcription Translation Codon Chart

An alien space ship carrying humans and aliens has just crashed. As expected, the alien and human bodies were burnt beyond recognition. There were a total of 5 bodies recovered. The alien bodies are remarkably similar to human bodies. 

Yet, it is determined that RNA is better for testing for human and nonhuman. You need to determine based on the given DNA sequence which bodies are human and which are non-human by testing for amino acid similarities in sequence.

It is your job to make sure the alien bodies are sent back to their planet before the aliens attack Earth and destroy it!!!

CCATAGCACGTTACCACGTGAAGGTAA

Copy the Human DNA sequence above (Hint, you need to convert the DNA sequence to RNA then find the amino acids in sequence so you need to divide the codons first.

Compare the DNA sequence to the RNA sequences recovered and determine which are human and which are alien.

1st Body: CAUCAGUGCUGC

First body recovered RNA sample 

2nd body: UGUACAUCAAUA

Recovered RNA sample

3rd Body: GGAAUAAACCGG

3rd body Recoved RNA sample

4th Body Sample: UGCUGUACGCCC

4th Body recovered RNA sample

5th Body sample: AUAGUUCAGUUA

5th body RNA body sample

Open Ended

It was later determined that sample 3 belonged to the pilot of the space craft and that pilot error caused the crash. Do you send a letter of apology or do you expect a letter of apology? Write the letter you would expect to get as an apology or write the letter you would send as an apology.

Questions next!!

Multiple Choice

Mutations are random.

• True

• False

Multiple Choice

A frameshift mutation where a nucleotide base is added

to the DNA sequence

• Insertion Mutation

• Deletion Mutation

• Substitution Mutation

• Chromosomal Mutation

Multiple Choice

A frameshift mutation where a nucleotide base

is removed from the DNA sequence.

• Deletion Mutation

• Substitution Mutation

• Translocation

• Silent Mutation

Multiple Choice

One nucleotide base is changed so only one amino acid

is affected

• Substitution Mutation

• Point Mutation

• Translocation

• Inverse Mutation

Multiple Choice

A substitution mutation that has no effect

on amino acids sequence

• Insertion Mutation

• Translocation

• Silent Mutation

• Deletion Mutation

Multiple Choice

A permanent change in the DNA sequence

which can affect a single gene or group of genes

• Homeostasis

• Somatic Cell

• Chromosomal Mutation

• Gene Mutation

Multiple Choice

Mutations are SOMETIMES helpful to the organism.

• true

• false

Multiple Choice

A point mutation where one nucleotide base replaces an original nucleotide base

• Inversion Mutation

• Chromosomal Mutation

• Translocation

• Substitution Mutation

Multiple Choice

Body Cell mutations can contribute to...

• Cancer

• Parkinson's Disease

• Bronchitis

• Heart Failure

Multiple Choice

What mutation has occurred here?

T-G-A-C-C-A

T-G-A-G-C-A

• Substitution

• Deletion

• Insertion

• Frameshift

Multiple Choice

Mutations are...

• Changes in the sequence of DNA

• Broken chromosomes

• Bad genes

Multiple Choice

DNA molecule segment is : TTA-CGC-AAG

The mutated DNA segment is TTC-GCA-AG. This is an example of ___ mutation.

• Substitution

• Deletion

• Insertion

• Inversion

Multiple Choice

Original: ATC CAT

Mutation: ATC GCAT

What mutation occurred?

• deletion

• insertion

• silent

• transverse

Multiple Choice

What type of substitution mutation has no effect

on amino acids sequence

• Insertion Mutation

• Translocation

• Silent Mutation

• Deletion Mutation

Multiple Choice

Mutations can be...

• Harmful

• Beneficial

• Neutral

• All of the Above

Multiple Choice

Mutations can be a result of...

• Environmental Exposure

• Lack of sleep

• Not enough exercise

Multiple Choice

Mutations are...

• Changes in the sequence of DNA

• Broken chromosomes

• Bad genes

Multiple Choice

Genetic Engineering is...

• The manipulation of an organism's genes

• The manipulation of an organism's chromosomes

Multiple Choice

Many mutations...

• Occur randomly

• Occur because of bad eating habits

• Occur because of lack of exercise

Multiple Choice

Body Cell mutations can contribute to...

• Cancer

• Parkinson's Disease

• Bronchitis

• Heart Failure

Multiple Choice

A point mutation that does not change the amino acid sequence is known as a(n) ____________ mutation.

• Frameshift

• Nondisjunction

• Inversion

• Silent

Multiple Choice

What type of mutation is shown in the image?

• Frameshift

• Nondisjunction

• Trinucleotide Repeat Expansion

• Silent Mutation

Multiple Choice

When a nucleotide is added to a DNA sequence, which of the following will occur?

• Point Mutation

• Silent Mutation

• Frameshift Mutation

• Gene Duplication

Multiple Choice

What is the term that refers to changes in the DNA sequence of a single gene?

• Mutagen

• Mutation

• Diversity

• Replication