ES Multiple Choice Final Exam Practice

The following petri dish shows the results of a 10 mL sample.  What is the count of the bacteria present?

• 35 CFU/ 100mL
• 3.5 CFU/ 100mL
• 350 CFU/ 100mL
• 70 CFU/ 100mL

It is most economically and environmentally sound to focus water resource management on:

• Increasing the water supply
• Developing desalination plants
• Controlling the “mining” of groundwater
• Increasing the efficiency of the way we use water

Throughout the world, the most water is used for:

• Transportation
• Industrial Processes
• Irrigation
• Human Consumption

The following image represents the agarose gel electrophoresis results from a restriction digest experiment. Lane 1 is a DNA ladder and Lane 2 is the DNA sample cut by a single restriction enzyme. What is the MINIMUM size of the uncut DNA fragment?

• 10
• 7.5
• 8
• 0.5

Restriction Enzyme A reads AGTC and cuts between G and T.  Cut the following DNA:
ACTCAGTCCTCTAAGCCAGTCCTCAAAAGTC
How many fragments are there?

• 1
• 2
• 3
• 4

If you cut the following plasmid with EcoRI, how many fragments would you have?

• 1
• 2
• 3
• 4

If you cut the plasmid with BamHI, what would be the sizes of the fragments created? (Values are in kb)

• 2,4,6,8
• 2,4,6,8,20
• 2,6,12
• 2,6,12,20

Shannon does not know who her father is.  There are three possibilities:  Jack, Daniel and Bill.  Who is the father?

• Jack
• Daniel
• Bill

This procedure, developed by Kary Mullis, is used to create many copies of DNA typically using a thermocycler

• Gel Electrophoresis
• Restriction Enzyme Digestion
• DNA Ligation
• Polymerase Chain Reaction

Algae blooms occasionally occur in the Chesapeake Bay during the summer.  What is the most likely cause of these blooms?

• Nutrients (Nitrate and Phosphate) from nonpoint source pollution
• The conversion of the wastewater treatment plants on the Chesapeake treating up to the tertiary level
• Discharge Pipes from industrial plants in Baltimore
• Air pollutants falling into the bay as it rains.