AP gel electrophoresis practice

Why do the fragments of DNA in gel electrophoresis travel away from the negative electrode?

• DNA is negatively charged so attracted to the positive end of the unit
• DNA is positively charged to attracted to the negative end of the unit
• the agarose gel in negatively charged
• the agarose gel is positively charged

Tags

NGSS.HS-PS2-5

What applications can gel electrophoresis be used for?

• Parental Testing

• Criminal Investigations

• comparing relationships of species

• All of the above

Tags

NGSS.HS-LS3-2

Which DNA fragment bands move faster and farther in a gel electrophoresis? 

• there is no way to tell 
• the largest ones
• the smallest ones
• none of these

In gel electrophoresis, the largest DNA fragment will appear

• closest to the starting wells
• farthest from the starting wells
• three quarters away from the starting wells
• it depends on how many fragments there are

Which is the primary purpose of using restriction enzymes in gel elctrophoresis?

• It allows the strands of DNA to be cut into various lengths for testing
• It restricts the number of base pairs that can be tested in a sample
• It makes the testing simpler by moving the strands into the gel faster
• It charges the DNA strands

Which suspect is linked to the crime scene by this DNA analysis

• Suspect A
• Suspect C
• Suspect D
• Suspect B

Shannon does not know who her father is.  There are three possibilities:  Jack, Daniel and Bill.  Who is the father?

• Jack
• Daniel
• Bill

Tags

NGSS.HS-LS3-1

This laboratory procedure is known as

• CLONING

• gel electrophoresis

• chromatography

• use of a dichotomous key

Gel electrophoresis is used to separate DNA fragments on the basis of which property?

• size

• color

• functions

• chromosomes

Restriction Enzyme A reads AGTC and cuts between G and T.  Cut the following DNA:
ACTCAGTCCTCTAAGCCAGTCCTCAAAAGTC
How many fragments are there?

• 1
• 2
• 3
• 4