8.5 Translation Quiz

What is the term for a three-nucleotide sequence that codes for an amino acid?

• base

• codon

• amine

• serine

How many amino acids are used to make up the all of the proteins in the human body?

• 16

• 20

• 23

• 46

A tRNA that carries the amino acid methionine pairs with which type of codon?

• serine codon

• tRNA codon

• start codon

• anticodon

Which phrase best describes translation?

• converts mRNA into a polypeptide

• catalyzes bonds between amino acids

• produces RNA from DNA molecules

• recycles tRNA molecules for reuse

Which of the following is the site of translation?

• vacuole

• lysosome

• nucleus

• ribosome

How many amino acids are coded for by the strand of mRNA shown below? Assume the reading frame begins with the first nucleotide.

CGAUAC

• 1

• 3

• 2

• 5

A template strand of DNA in a gene reads:

3' CTC CGC TTT TAG 5'

Using the codon chart, what is the sequence of amino acids that is produced after translation?

• Gln - Ala - Asn - Met

• Leu - Arg - Phe - Stop

• Glu - Ala - Lys - Ile

• Glu - Ala - Lys - Thr

Tags

NGSS.HS-LS1-1

The following is an mRNA transcript. Using the codon chart, find the stop and start codons (they are not simply the first and last codons). Hint: Methionine is always the start codon. How many amino acids are going to be translated from this gene?

AAUUUGCAUGUUGGCAAAUCGUCCUUGAGG

• 10

• 7

• 5

• 2