PBS Final Review Fall 2020

When blood clumps or forms visible islands in the still liquid plasma, it is called

• binding

• agglutination

• antigenosis

• plasmolysis

What is this patient's blood type?

• A

• AB

• B

• O

Hair evidence at a crime scene is considered class evidence. Alone it can not be used to identify a specific individual. If the follicle is attached, what allows hair to become individualized evidence?

• Cortex

• Medulla

• Pigment

• DNA

Fingerprint evidence is individual evidence; no two people have been found with the exact same fingerprint pattern. Each fingerprint has as many as 150 points, called minutiae. How many minutiae points must match for a confirmation of identification.

• 150

• 20

• 12

• 20

What are pyrimidines in DNA?

• Types of phosphates

• Types of sugars

• Types of bases

Identify the structure labeled I

• sugar

• phosphate

• base

How many cuts would be made in the DNA using HAElll?

AATTATATGTGCCCTGGCCTAGCGGCCTATAGC

TTAATATACACGGGACCGGATCGCCGGATATCG

• 1

• 2

• 3

• 0

E marks the evidence found at the crime scene.

S1 and S2 mark the two suspects. Which suspect matches the DNA found at the crime scene?

• S1

• S2

Which of the following careers would NOT be a wise choice for someone interested in death investigation?

• Coroner

• 911 Operator

• Forensic Pathologist

• Crime Scene Investigator

Which would be the first step in a crime scene investigation?

• Interview witnesses

• DNA analysis

• Fingerprint analysis

• Secure the scene