2. DNA Manipulation Techniques

Which of the following statements about these endonucleases is correct?

• If the chromosome was only digested with EcoRI, 6 fragments would be produced.

• If the chromosome was only digested with BamHI, 4 fragments would be produced.

• If the chromosome was digested with both EcoRI and BamHI, 11 fragments would be produced.

• If the chromosome was digested with both EcoRI and BamHI, 5 fragments would be produced.

Which of the following shows the correct order of steps in the polymerase chain reaction (PCR)?

• Annealing, denaturing, extending

• Denaturing, extending, annealing

• Extending, denaturing, annealing

• Denaturing, annealing, extending

Which of the following is not a process involved in the use of CRISPR-Cas9?

• Ligase is also added alongside CRISPR-Cas9 to repair DNA that has been cut.

• Cas-9 cuts both strands of DNA at the target sequence.

• CRISPR or guide RNA allows for a specific section of the genome to be targeted.

• Specific nucleotides can be added or deleted at the site of the cut made by Cas-9.

If CRISPR-Cas9 is used in the future in humans, and any faulty DNA is altered, the organism would be classified as

• both transgenic and genetically modified.

• genetically modified but not transgenic.

• transgenic but not genetically modified.

• neither genetically modified nor transgenic.

During a paternity dispute, gel electrophoresis was conducted and the results are shown below. Who is the likely father in this case?

• Father A

• Father B

• Father C

• Father D

During gel electrophoresis

• DNA moves from the positive terminal towards the negative terminal.

• larger DNA fragments move further down the gel compared to smaller DNA fragments.

• a buffer solution is used to ensure the gel remains at an appropriate temperature.

• loading dye is added so bands can be visualised under UV light.

Heat shock is an important process during the making of transformed bacteria. Heat shock

• uses an electric pulse to make the plasma membrane more permeable.

• involves placing bacteria at 100 °C until the plasmid is taken up.

• involves moving bacteria from an ice-cold solution to 42 °C to increase the fluidity of plasma membrane.

• ensures that the antibiotic resistance genes are being expressed.

The following plasmid, pUC18, was used to create a recombinant plasmid. The two genes within this plasmid are AmpR, which creates resistance to the antibiotic ampicillin, and lacZ, which allows bacteria to break down galoctosidase, an enzyme that converts a colourless X-gal substrate into a blue product. A foreign gene was inserted into the BamHI site shown below. This plasmid was then taken up by E. coli. When grown on a plate containing ampicillin and X-gal, you would expect that

• bacteria with the recombinant plasmid would grow as colonies and be blue.

• bacteria with the recombinant plasmid would grow as colonies and be white.

• bacteria would grow as a lawn of bacteria and be blue.

• bacteria would grow as a lawn of bacteria and be white.

Which of the following enzymes is not required during the process to make a recombinant plasmid and produce human insulin?

• Ligase

• Endonuclease

• RNA polymerase

• Taq polymerase

The following double-stranded sequence of DNA contains non coding regions as well as a desired gene. The desired gene is shown in bold. 

AAGAGATCTCGATTCGAGGCCCGTACAGATCTGGATCC
TTCTCTAGAGCTAAGCTCCGGGCATGTCTAGACCTAGG

Which endonuclease would be the best choice to use to cut out the gene to be incorporated into a recombinant plasmid?

• BamHI

• BglII

• HaeIII

• TaqI