bio 2

Isoginkgetin is a substance that can interfere with spliceosomes in eukaryotic cells. Which molecules involved in gene expression would be impacted by the presence of isoginkgetin?

• DNA

• pre-mRNA

• mature mRNA

• protein

Telomerases perform reverse transcription and are active only in certain human cells.

• True

• False

How are leading and lagging strands made differently during replication?

• Lagging strands are built in fragments, and leading strands are made continuously.

• Lagging strands are made from 3' to 5', and leading strands are made from 5' to 3'.

• Leading strands require more primers to facilitate replication than lagging strands.

• Leading strands are made in all cells, but only eukaryotes produce lagging strands.

Which of the following describe limitations of DNA polymerases (select all that apply)?

• DNA polymerases only end replication by reading terminators.

• DNA polymerases only begin replication if a primer is present.

• DNA polymerases only read template strands in one direction.

• DNA polymerases only build new strands by adding to 5' ends.

• DNA polymerases only build the leading strand for replication.

Which primers should be used to amplify this segment of DNA through PCR (select all that apply)?

3'-CTGACATGTACGTAG-5'

5'-GACTGTACATGCATC-3'

• 3'-GUAG-5'

• 3'-GTAG-5'

• 5'-CATC-3'

• 5'-GACT-3'

• 5'-GACU-3'

Topoisomerase

• prevent the shortening of chromosomes during replication in eukaryotes

• relieve tension ahead of replication forks while the double helix unwinds

• break hydrogen bonds to separate antiparallel strands of DNA molecules

• synthesize short pieces of RNA that will enable DNA replication to begin

• finish primer replacement by forming missing bonds in new DNA strands

DNA Ligases

• break hydrogen bonds to separate antiparallel strands of DNA molecules

• prevent the shortening of chromosomes during replication in eukaryotes

• relieve tension ahead of replication forks while the double helix unwinds

• finish primer replacement by forming missing bonds in new DNA strands

• synthesize short pieces of RNA that will enable DNA replication to begin

Which of these mechanisms can regulate gene expression in a eukaryote (select all that apply)?

• protein modifications after translation

• alternatively splice the exons in mRNA

• signal from other cells or environment

• enable or block transcription of genes

If this entire sequence of DNA codes for amino acids and the underlined nucleotide is changed from G to C, how is this mutation categorized?
5’–TACCTTCGTAAGATGCCGCAT–3’

• nonsense

• missense

• frameshift

• silent

If the base pair below is changed from C-G to A-T, how would the mutation be categorized?

• missense

• nonsense

• silent

• frameshift