RNA and Protein Synthesis

What is the complementary mRNA strand for the DNA sequence AATGGGCTATGCATGATACT?

• TTACCCGATACGTACTATGA

• UUACCCGAUACGUACUAUGA

• AATGGGCTATGCATGATACT

• ATTGCCGATACGTACTATGA

In the process of ________, RNA polymerase binds to DNA and separates the DNA strands during the synthesis of a complementary RNA molecule.

• differentiation

• transcription

• replication

• translation

Translation involves several different types of RNA molecules. Which statement best describes how tRNA molecules assemble amino acids into a polypeptide?

• One tRNA molecule assembles the polypeptide, and the others assist it

• Three tRNA molecules assemble the polypeptide, and the others assist them

• Each tRNA molecules assembles a different part of the polypeptide, and all at the same time

• The different tRNA molecules act in a specific order, one after the other like an assembly line

There are three main types of RNA: messenger RNA (mRNA), ribosomal RNA (rRNA), and transfer RNA (tRNA). Which type or types of RNA contain a copy of the instructions that a gene carries?

• mRNA only

• rRNA only

• mRNA and tRNA

• mRNA, rRNA, and tRNA

Tags

NGSS.HS-LS3-1

Which of these revisions to the model would be most useful for the researcher to include to show the transcription of DNA to form mRNA?

• Replace thymine (T) with uracil (U) in the DNA molecule

• Keep the two strands of the DNA molecule joined together

• Identify promoter and "stop" regions on the DNA molecule

• Divide the DNA molecule into pieces that are 40 to 50 bases long

A molecule of tRNA has three bases called an anticodon. What does the anticodon do during translation?

• The anticodon binds to a complementary codon on mRNA

• The anticodon binds to another tRNA molecule

• The anticodon binds to a specific amino acid

• The anticodon binds to the promoter, a region of DNA

Which conclusion about the genetic code is most strongly supported by the evidence presented in the diagram?

• All amino acids are encoded by only one codon

• Many amino acids are encoded by more than one codon

• Every codon may encode for two or more amino acids

• Many codons, all encode for exactly two amino acids

To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?

• Calculate the frequencies of each letter

• Count the number of letters in the list

• Separate the list into three-letter "words"

• Separate the list into two-, three- and four-letter "words"

A molecular biologist is developing a computer model of the transcription of a gene into RNA. Which event should be included in the model before transcription occurs?

• The removal of introns from the gene

• RNA polymerase inserting itself into the gene

• RNA polymerase binding to a region near the gene, called the promotor

• The joining together of exons to form the gene

The "language" of RNA is called the __________ ________, and it uses three-letter "words" called __________.

• transcription strategy, nucleotides

• genetic code, codons

• nucleotide strategy, polypeptides

• substitution mutation, nucleotides

Tags

NGSS.HS-LS1-1