Biology 2581 Tutorial 3 Section 19 Quiz

Which of the following characteristics do both siRNA and miRNA-mediated methods of gene activity alteration share?

• They both have a genic source of dsRNA
• They both cleave their target
• They both suppress parasitic genetic elements like viruses and transposons
• They both have perfect complementarity to a specific target

Which of the following statements are true? 1. Episomes with a dominant selectable marker can be transformed into competent cells to select for those cells that have taken up the episome. 2. When DNA is injected into organisms with larger cells, transposons can mediate transformation via a copy-and-paste mechanism to help reintroduce the DNA. 3. Mutational analysis can help identify the sequences in a gene that are important for its function by introducing mutations in different regions of the gene. 4. Site specific recombination randomly introduces the marker and gene of interest from the recombinant plasmid into the genome.

• a) 1, 2, and 3
• b) 1 and 3
• c) 2 and 4
• d) 4 only

Researchers want to discover the gene responsible for a rare and complex genetic disorder. To understand the gene associated with the phenotype, researchers should use _________.

• Epigenetics
• Forward genetics
• Reverse genetics
• Comparative genomics
• Transcriptomics

In Drosophila which symptom may be a result of a developmental condition originating only from the mother?

• Headless larvae
• Legs in place of antenna
• Second set of wings
• Proboscis replaced with antenna
• None of the above

You perform a cross between mutant alleles arg1 and arg4 and determine that the diploid formed is arg(+). You also perform a cross between mutant alleles arg2 and arg3 and determine that the diploid is arg(-). Which of the following statements best describe the complementation analysis done on the arg gene.

• A.) arg1/arg4 are an example of non-complementation, arg2/arg3 are an example of complementation
• B.) arg1, arg3, and arg4 are all part of the same complementation group
• C.) all four of these alleles are located on the same gene
• D.) arg1/arg4 are an example of complementation, arg2/arg3 are an example of non-complementation
• E.) Both A and B are correct

--- genetics refers to the process of going from genotype to phenotype. To reintroduce DNA into the cell, you must first transform the cell. ---- is a method of transformation where DNA is randomly inserted into the chromosome (not necessarily at the locus of DNA you are introducing).

• a. forward, episome
• b. forward, random insertion
• c. forward, homologous Recombination
• d. reverse, random insertion
• e. reverse, episome

Researchers in a laboratory expose mice to a mutagenic chemical, inducing random mutations across the genome. The researchers then observe the mice for the development of varied phenotypes. By identifying mice that develop mutations associated with phenotypes different from the wild type, and analyzing their genomes, the researchers can pinpoint the genetic mutations associated with problem phenotypes.

• reverse genetics
• comparative genetics
• transgenic genetics
• forward genetics
• forward genetics and transgenic genetics

Researchers in a laboratory expose mice to a mutagenic chemical, inducing random mutations across the genome. The researchers then observe the mice for the development of varied phenotypes. By identifying mice that develop mutations associated with phenotypes different from the wild type, and analyzing their genomes, the researchers can pinpoint the genetic mutations associated with problem phenotypes. What genetic approach was utilized ?

• reverse genetics
• transgenic genetics
• comparative genetics
• forward genetics

What is required for successful binding of Cas9 to DNA target sequence?

• PAM sequence
• PASH-1
• Tracer DNA
• Methylation of DNA target sequence

Write the first 10 bases of the RNA sequence 5’ to 3' for a base guide RNA sequence to create a double stranded break in the following sequence: TAGCATTACGAGCCTATCGGTAGAGCAGCATTA

• AUGCCAUCUC
• UCGUAAUGCU
• CUCUACCGAU
• AAUGCCAUCU
• None of the above.