Biology 2581 Tutorial 3 Section 35

Which of the following is NOT a crucial molecular mechanism involved in the regulation of epigenetics?

• DNA methylation
• RNA interference
• Transcription
• Histone modification
• Post-translational modifications

In a complex regulatory pathway involving genes A, B, C, and D, gene A's function is epistatic to gene B, gene B's function is epistatic to gene C, and gene C's function is epistatic to gene D. If gene D's function is disrupted, which of the following outcomes would be expected?

• Gene C's function will be disrupted, affecting the functions of genes A and B.
• Only gene D's function will be disrupted, leaving the functions of genes A, B, and C unchanged.
• Gene A's function will be disrupted, affecting the functions of genes B, C, and D.
• Gene B's function will be disrupted, affecting the functions of genes A and C.
• Gene C's function will be disrupted, affecting the functions of genes A, B, and D.

What will occur if a gap gene in the middle of one of the female strands on the x chromosome is deleted, resulting in a loss of the x inactivation

• 1. The strand will skip over the deleted gene and x inactivation will not occur.
• receptor? 2. The entire section following the gap gene will be deleted causing a large mutation, and no x inactivation will occur causing lethality
• 3. The entire section following the gap gene will be deleted causing a large mutation, and x inactivation will still occur
• 4. The deleted gap gene will be removed, and the rest of the sequence following this will be moved up as if the deleted gene was never there in the first place, and x inactivation will still occur
• n/a

Which one of the following statements does NOT accurately distinguish between siRNA and miRNA

• SiRNA is derived from exogenous sources, miRNA is derived from endogenous sources
• Though the miRNA process occurs in eukaryotes, the siRNA does not
• Though both miRNA and siRNA utilize Argonaute protein, they use different versions of the protein
• Both the miRNA and siRNA process utilize the dicer enzyme to process the dsRNA into fragments

Which of these statements best explains how genome variants are utilized in genetics research?

• Genome variants are used in both forward genetics and reverse genetics: to identify genes linked to traits and to understand the function of the know genes by introducing mutations.
• Genome variants are only used in forward genetics to study known genes by introducing mutations and observing phenotypic changes.
• Genome variants only used in reverse genetics to find genes associated with traits by introducing random mutations.
• Genome variants are used in forward genetics to find genes linked to traits by introducing random mutations, and in reverse genetics to study known genes without mutations.
• None of the above

Methylase is an enzyme that acts during the process of restriction modification immunity in bacteria by adding methyl groups to DNA. What would be the result if methylase underwent a loss of function mutation?

• The restriction enzyme would not be able to recognize the bacteriophage DNA and would not cut its phage DNA
• Bacteriophages would be unable to inject their DNA into the bacterial cell to propagate its phage cells
• The structural integrity of the cell wall of the bacteria will be significantly decreased without methylase
• The genomic DNA would be cut up at sites recognized by the restriction enzyme as a result of not being methylated
• The bacteriophage would be able to inject its DNA directly into the genomic DNA of the bacteria

Which one of the following is NOT a difference between siRNA and miRNA?

• siRNA have perfect complementarity with their target, miRNA typically do not
• miRNA has a transgenic origin of dsRNA, while siRNA does not
• miRNA can have multiple targets, while siRNA targets are more specific
• siRNA often cleaves its target, while miRNA typically does not and instead inhibits translation
• all of the above

In the context of forward genetics, what is the primary goal of a genetic screen?

• To compare the genetic sequences of different species.
• To identify individuals with specific phenotypic traits in a population.
• To determine the DNA sequence of a particular gene
• To identify genes that are responsible for a specific phenotype
• To identify phenotypes that are responsible for a specific gene

Reengineering Cas9 can create problems, such as introducing double strand breaks. What method may be used to fix this?

• Homologous recombination
• Introducing PAM sequence into the DNA
• Using a restriction enzyme
• End-end joining

Write the first 10 bases of the RNA sequence 5’ to 3' for a base guide RNA sequence to create a double stranded break in the following sequence: TAGCATTACGAGCCTATCGGTAGAGCAGCATTA

• AUGCCAUCUC
• UCGUAAUGCU
• CUCUACCGAU
• AAUGCCAUCU
• None of the above.