Relationships and Biodiversity Lab Regents Practice

The diagram below represents a laboratory apparatus.

This apparatus is used to

• identify the molecular bases in DNA

• detect chemical toxins in the air

• stain specimens before observing them with a microscope

• separate a mixture of plant pigments

Base your answer to the following question on the chart below and on your knowledge of biology.

Which evolutionary tree best represents the information in the chart?

• 
• 
• 
• 

Tags

NGSS.HS-LS4-1

NGSS.HS-LS4-2

Paper chromatography is a laboratory technique that is used to

• separate different molecules from one another

• stain cell organelles

• indicate the pH of a substance

• compare relative cell size

In preparation for an electrophoresis procedure, enzymes are added to DNA in order to

• convert the DNA into gel

• cut the DNA into fragments

• change the color of the DNA

• produce longer sections of DN

Cytochrome c is an enzyme located in the mitochondria of many types of cells. The number of differences in the amino acid sequences of Cytochrome c from different species are compared to human Cytochrome c in the data table below.

Cytochrome c is most likely a

• protein molecule

• material containing genes 

• carbohydrate that is absorbed by cells 

• component of the membrane around the cell

Tags

NGSS.HS-LS1-1

This laboratory technique is known as

• 
  gel electrophoresis

• DNA replication

• protein synthesis

• genetic recombination

This technique used to analyze DNA directly results in

• 
  synthesizing large fragments of DNA

• separating DNA fragments on the basis of size

• producing genetically engineered DNA molecules

• removing the larger DNA fragments from the samples

Tags

NGSS.HS-LS1-1

To demonstrate techniques used in DNA analysis, a student was given two paper strip samples of DNA. The two DNA samples are shown below.

Sample 1: ATTCCGGTAATCCCGTAATGCCGGATAATACTCCGGTAATATC

Sample 2: ATTCCGGTAATCCCGTAATGCCGGATAATACTCCGGTAATATC

The student cut between the C and G in each of the bolded CCGG sequences in sample 1 and between the As in each of the bolded TAAT sequences in sample 2. Both sets of fragments were then arranged on a paper model of a gel.

The results of this type of DNA analysis are often used to help determine

• the number of DNA molecules in an organism

• if two species are closely related

• the number of mRNA molecules in DNA

• if two organisms contain carbohydrate molecules

Scientists hypothesize that cabbage, broccoli, cauliflower, and radishes developed along a common evolutionary pathway. Which observation would best support this hypothesis?

• Fossils of these plants were found in the same rock layer.

• Fossils of these plants were found in the same rock layer.

• These plants live in the same environment.

• These plants have similar proteins.

Tags

NGSS.HS-LS4-1

The diagram below shows the results of a test that was done using DNA samples from three bears of different species. Each DNA sample was cut into fragments using a specific enzyme and placed in the wells as indicated below. The DNA fragments were then separated using gel electrophoresis.

Gel electrophoresis is used to separate DNA fragments on the basis of which property?

• size

• color

• functions

• chromosomes