PBS

When a protein needs to be made, a signal is sent to a cell to turn on the ____ that codes for the needed protein. This is the start of transcription.

Tags

NGSS.HS-LS1-1

During translation, small organelles called _________ read the mRNA sequence.

In your notebook, you transcribed this segment of DNA. GATCGATACCATTCGGCGCATACTTCG How many codons will be on the resulting mRNA strand?

• 9

• 27

• 13

• 20

This is the same strand of DNA as before:

GATCGATACCATTCGGCGCATACTTCG

Transcribe enough of this strand to determine what amino acid the second codon calls for.

• arginine

• alanine

• serine

Tags

NGSS.HS-LS1-1

Which letter represents amplitude? (a)  

• A

• B

• C

• D

• E

Tags

NGSS.MS-PS4-1

Be careful and study the codon wheel/chart: How many different codons can produce serine?

• 2

• 4

• 6

What is significant about the DNA strand TAC?

• it will signal the start of transcription

• it will signal that transcription should stop

• it means methionine

• it means valine

Estimate the approximate time of death for the following situation:

A body was found with no evidence of rigor.

• 2 - 6 Hours

• 8 Hours

• Less than 2 Hours

• Less than 1 Hour

The cooling of body temperature after death is:

• algor mortis

• livor mortis

• rigor mortis

• pallor mortis

Of the options given, which are the first to arrive at a corpse?

• Parasitic wasps

• Beetles

• Blowflies

• Flesh flies and house flies