Worksheets3.3.1 Gel Electrophoresis
Total questions: 10
Worksheet time: 8mins
This laboratory procedure is known as
CLONING
gel electrophoresis
chromatography
use of a dichotomous key
In preparation for an electrophoresis procedure, enzymes are added to DNA in order to
convert the DNA into gel
cut the DNA into fragments
change the color of the DNA
produce longer sections of DNA
The parents of a new baby believe they brought the wrong child home from the hospital. Gel electrophoresis was performed using DNA samples from the parents and the child. A section of the gel
electrophoresis results is shown below. Which conclusion is valid based on the gel electrophoresis results?
They have the correct child, because her genetic information is identical to that of the father.
They have the wrong child, because her genetic information does not match that of either parent.
They have the correct child, because her genetic information came from both parents.
They have the wrong child, because her genetic information matches only that of the mother.
A student performed a gel electrophoresis experiment. The results are represented in the diagram
below. Compared to the fragments at the top of the gel, the fragments at the lower end are
larger, and move slower
larger, and move faster
smaller, and move faster
smaller, and move slower
This technique used to analyze DNA involves the
synthesis of new DNA strands from subunits
separation of DNA fragments based on size
production of genetically engineered DNA molecules
removal of defective genes from DNA
Sample 1: ATTCCGGTAATCCCGTAATGCCGGATAATACTCCGGTAATATC
Sample 2: ATTCCGGTAATCCCGTAATGCCGGATAATACTCCGGTAATATCThe results of DNA analysis are often used to help determine
the number of DNA molecules in an organism
if two species are closely related
the number of mRNA molecules in DNA
if two organisms contain carbohydrate molecules
Once DNA has been extracted from the nucleus of a cell, it is exposed to ______ ______ that act like biochemical scissors to cut the DNA.
restriction enzymes
gel agarose
clotting factors
electric shock
