the backbone of DNA is composed of alternating sugars and

A method used to rapidly make multiple copies of a specific segment of DNA.

sequence of repeating bases in the non-coding regions of DNA that are used in DNA profiling

Parts of the cell where DNA can be found: nucleus and

According to the dna evidence, which suspect left DNA at the crime scene?

The FBI database that stores DNA profiles

A section of DNA that codes for a specific trait.

In this DNA fingerprint, the _______ pieces travel the farthest. (blue)

DNA is ______ evidence.

Alternate forms of a trait (the possibilities) are called

A cell structure that contains genetic information along strands of DNA.

A method of separating molecules, such as DNA, according to their size and electrical charge.

Which term is defined as all the DNA found in a cell?

What is the STR in the following strand of DNA? AGTCAAGCTCGCTCGCTCGCTCAAT

What term is given to the coding region of DNA?

If one parent has the alleles (4,8) and the other parent's alleles are (7,12) what are the possible genotype combinations their child could inherit?

What term describes when a child inherits the same allele from both parents (5,5)

What is the name of the graphic display that results from STR analysis?

On an electropherogram, alleles are represented by...

If there is only one allele (one peak) on the electropherogram for a particular locus, what does that tell you about the genotype?

At which locus is this individual heterozygous? (check all that apply)

At which locus is this individual homozygous? (check any that apply)