DNA and restriction enzyme Digestion

What is the primary purpose of using restriction enzymes in gel electrophoresis?

• It restricts the number of base pairs that can be tested in a sample.
• It makes the testing simpler by moving the strands into the gel faster.
• It allows the DNA strands to be charged so the electrical current can send the strands into the gel.
• It allows the strands of DNA to be cut into various lengths for testing.

Gel electrophoresis separates DNA according to size. Which is true regarding movement of the DNA?

• The longest pieces of DNA will move the least distance.
• The longest pieces of DNA will move the greatest distance.
• The shortest pieces of DNA line up along the middle.
• The shortest pieces of DNA line up an equal distance from the middle

A ____ is a small ring of DNA found in a bacterial cell.

• virus
• plasmid
• gene bullet
• PCR

Some restriction enzymes produce "sticky ends". Sticky ends are . . . 

• single-stranded DNA "overhangs" that can bind to complementary DNA
• smooth cuts that are sticky due to the "goo" left behind by the enzyme
• The two wires (black and red) on a gel box
• The surface of the LB agar plates so that bacteria can grow

Restriction Enzyme A reads AGTC and cuts between G and T.  Cut the following DNA:
ACTCAGTCCTCTAAGCCAGTCCTCAAAAGTC
How many fragments are there?

• 1
• 2
• 3
• 4

What is a restriction digest?

• Using enzymes to cut DNA at specific locations
• Using enzymes to replication DNA
• Using science to make genetic clones
• Analysis of DNA with an electrical current

What charge does DNA carry?

• Positive
• Negative
• Neutral

In gel electrophoresis, DNA moves... 

• Toward the positive electrode
• Toward the negative electrode
• According to its varied charge
• From lane to lane depending on size

What units are used to measure DNA fragments?

• millimeters (mm)
• microliters (uL)
• micrometers (um)
• base pairs (bp)

What are 4 components of gel electrophoresis?

• Scissors, Electricity, a Buffer and a Microwave
• Gel, Electricity, Meiosis and a Buffer
• Scissors, Meiosis, a Microwave and Agarose
• Gel, Electricity, a Buffer and DNA