Restriction enzymes and electrophoresis

What is a restriction enzyme?

• An enzyme which hydrolyses peptide bonds between nucleotides

• An enzyme which hydrolyses hydrogen bonds between nucleotides

• An enzyme which hydrolyses phosphodiester bonds between nucleotides

• An enzyme which hydrolyses phosphodiester bonds between anticodons

The unpaired nucleotides produced by the action of restriction enzymes are referred to as.....

• Restrictions fragments

• Blunt ends

• Sticky end

• Codons

If the target sequence or restriction site is ^5'GCTTCG^3', what is the complementary sequence read in the 3'-5' direction?

• GCUUCG

• GCTTCG

• CGUUCG

• CGAAGC

How many fragments would be produced in the following DNA when is treated with HindIII and Alul?

ATCTAGCTGCGCAAGCTTGCTAGCTGCAGCTCGAGCT

TAGATCGACGCGTTCGAACGATCGACGTCGAGCTCGA

• 3

• 4

• 5

• 6

Restriction enzyme could be used to cut DNA because the shape of each ​ (a)   is complementary to each ​ (b)  

• recognition site
• sticky ends
• Bunt ends
• Cofactors
• sequence of DNA
• active site
• nucleotides
• palindromic nucleotides

Which method(s) will work to visualise the bands on the gel?

• add a radioactive stain, view with photographic film

• add a fluorescent stain and view with photographic film

• add a fluorescent stain, view with UV light

• add a radioactive stain, view with UV light

Which part of the DNA molecule makes it negatively charged?

• The nitrogenous bases

• The ribose sugars

• The phosphate groups

• The deoxyribose sugars

When the power supply is switched on the DNA starts to migrate through the gel from the​ (a)   ​ to the​ (b)   ​

• Cathode
• Anode
• Electrode
• Agarose
• Power supply

Reorder the steps of carrying out electrophoresis:

• Remove the gel and stained to visualise the bands

• Cut DNA sample with restriction enzymes and amplify them by PCR

• Loading sample with a micropipette

• Covered the chamber and apply electrical current

• Place Agarose gel in the chamber facing well to negative electrode and add buffer solution

Select the band with the longest DNA fragment