Bio unit 1

Which nitrogenous bases are found in RNA and also classified as purines

• uracil

• thymine

• guanine

• cytosine

• adenine

If 23% pf nucleotides in DNA sample contain guanine, what percent contains cytosine?

• unknown

• 23%

• 46%

• 27%

• 54%

Dna is less stable and has more variation in structure and function than RNA

• true

• false

which structural level refers to the order in which various amino acids are bonded in a protein

• tertiary

• secondary

• quaternary

• primary

which of the following are components of RNA nucleotides

• phosphate

• ribose

• R group

• nitrogenous base

• deoxyribose

RNA is less stable and has more variation in structure and function than DNA

• true

• false

how many different RNA molecules can be made by bonding four nucleotides together

• 625

• 3125

• 5120

• 32768

• 256

if 3'- TGATCGCA-5' is part of the template strand inside a gene, what would be the product of the transcription

• 5'- ACUAGCGU- 3'

• 3'- UGAUCGCA-5'

• 5'- UGAUCGCA-3'

• 3'- ACUAGCGU-5'

Translate 5' -[cap] UUCAUGGAUCAUCUGUGAGUAGCC [poly(A)]- 3' into a protein

• phe-met- asp- his- leu

• met-ser-val-tyr

• met-asp-tyr-val

• met-asp-his- leu

what is correct order for these structures smallest to largest

• codon-mRNA- ribose-nucleotide

• ribose- nucleotide- codon- mRNA

• ribose- codon- nucleotide-mRNA

• nucleotide-ribose-mRNA- codon