DNA Structure and Function Quiz

If 35% of an organism’s DNA is thymine, what is the percentage of guanine?

• 15%

• 35%

• 70%

• 50%

How does the double-helical structure of DNA explain how the molecules can be copied or replicated?

• Because of base pairing, each strand has all the information to serve as a template for the synthesis of the other strand.

• Each strand receives the information from the DNA polymerase attached to the replication fork.

• The nitrogenous bases on one strand are copied to the other strand.

• The nitrogenous bases line up on each strand and are attached to each other.

As cells pass through the cell cycle, their volume of DNA alternately halves and doubles. Which statement about DNA correctly explains this pattern?

• DNA replication occurs during all phases of the cell cycle.

• DNA replication occurs only during the G₁ phase of the cell cycle.

• DNA replication occurs only during the S phase of the cell cycle.

• DNA replication occurs randomly and is unrelated to the cell cycle.

A scientist uses radioactive isotopes to label a double-stranded molecule of DNA. Then the DNA undergoes replication in a non-radioactive medium. Where are the two original radioactive strands of DNA?

• Both strands are intact, and both are part of the same molecule of DNA.

• Both strands are intact, and both are part of different molecules of DNA.

• One strand is intact, and the other strand is broken apart and distributed among the new DNA molecules.

• Both strands are broken apart, and their pieces are distributed among the new DNA molecules.

Which of the following events occurs in DNA replication?

• Regulatory proteins bind to all of the nucleotides on the DNA molecule.

• Enzymes “unzip” the DNA molecule by breaking hydrogen bonds between base pairs.

• Replication starts from a single point and proceeds in two directions until the entire chromosome is copied.

• Replication only uses one side of a DNA double helix strand.

What would happen if a cell divides before DNA replication is completed?

• Daughter cells would receive incomplete genetic information, but would be able to function like normal.

• Daughter cells would receive incomplete genetic information, but would regain lost information during transcription.

• Daughter cells would contain all genes of the parent cell, but would not function normally.

• Daughter cells would receive incomplete genetic information and never regain it, and they may not function properly or survive.

The sequence of nitrogenous bases on a portion of a strand of DNA is TACG. From left to right, what is the corresponding sequence of the complementary strand?

• T-A-C-G

• A-T-G-C

• G-C-A-T

• C-G-T-A

Alvin is studying a model of the chemical structure of a common nucleic acid. He observes that the nucleic acid consists of four nitrogenous bases: adenine (A), cytosine (C), guanine (G), and uracil (U). Alvin’s observation most strongly supports which of these conclusions?

• The nucleic acid is a form of RNA, and is not DNA.

• The nucleic acid is either mRNA or rRNA, but not tRNA.

• The nucleic acid is either RNA or DNA.

• The nucleic acid is DNA, and is not RNA.

A molecular biologist is developing a computer model of the transcription of a gene into RNA. Which event should be included in the model before transcription occurs?

• the removal of introns from the gene

• mRNA being read by a ribosome

• RNA polymerase binding to a region near the gene, called the promoter

• the joining together of exons to form the gene

Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below. AUGCCACAGGUUCAUCCGAA… To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?

• Calculate the frequencies of each letter.

• Count the number of letters in the list.

• Separate the list into three-letter “words.”

• Separate the list into two-, three- and four-letter “words.”