According to the Fluid Mosaic Model, proteins of the membrane are

Transport across membrane that is against the concentration gradient is known as

A cell in the basal layer of the skin contains 46 chromosomes and divides by mitosis to produce new skin cells. After ten successive divisions, how many chromosomes will the basal cell have?

Short horn (S) in cows is dominant to long horn, while black coat (B) is dominant to brown coat. Cows that are heterozygous for both characteristics were test crossed and produced 100 offspring. How many offspring would have short horn and black coat?

Night blindness is a condition in which the affected individuals have difficulty seeing in dim light. The allele for night blindness is recessive. A couple who are both carries for this gene have three children who have night blindness. What is the probability that their next child will be a carrier?

Which is the possible term used to describe the phenomenon when a red-flowered snapdragon is crossed with a white-flowered snapdragon plant producing a pink-flowered progeny?

Determine the sequence of genes along a chromosome based on the following recombination frequencies:

A – B, 8 map units ; A – C, 28 map units ;

A – D, 25 map units; B – C, 20 map units;

B – D, 33 map units.

According to Hardy-Weinberg law, genetic equilibrium is achieved when

A population in Hardy-Weinberg equilibrium,16% of the individuals show the recessive traits. What is the frequency of the dominant allele in the population?

1. Which of the following is the CORRECT sequence of enzyme use for the synthesis of the lagging DNA strand after the formation of a replication bubble?

1. Ligase 2. Helicase 3. Primase

4. DNA polymerase

A sequence of DNA bases from a sense strand is given as

TACATGTTCGAGCATGTAACG

The mRNA codons for the respective amino acids are given below:

UAC – tyr CUC – leu CCU - pro

AAG – lys GUA – val AGU - ser

GAG – glu CAU – his GGC - gly

AUG – met UGC – cys GGA – arg

A mutation in the regulatory gene of an inducible operon of E. coli would result in

Which of the following is TRUE about mutation?

Which of the following mutations have a harmful effect on an organism?

FIGURE 1 shows non-disjunction during meiosis of an organism. What will be the number of chromosomes for zygote if gamete P and Q fuse with normal gamete?

The table above shows the types of mutation and their examples.

Which of the following about the types of mutation and their examples is CORRECT?

Which statement BEST describes a recombinant DNA?

Unpaired nucleotides produced by restriction enzymes at one end of DNA fragment is known as the

Which is the main reason that explains biotechnology has advanced rapidly until it can be applied to almost all aspects of human life?

DNA plasmid is shown in the diagram above. One of the steps in the production of recombinant bacteria capable of producing human insulin is the insertion of the insulin gene into the plasmid. Screening was done by culturing the bacteria in agarose medium containing ampicillin.

Which result shows that human insulin gene has been taken in by the bacteria cultured in ampicillin?

What is the importance of restriction endonucleases in a bacterial cell?

Screening is

FIGURE 2 shows reproductive stages of flowering plant. Identify process J and K.

Which of the following sequences of spermatogenesis is CORRECT?

FIGURE 3 shows a part of the seminiferous tubule. L, M, N and O represent cells in various stages of development. Choose the CORRECT statement.

The following are the consequences when ovaries are removed from a cancer patient EXCEPT

Which of the following is a function of the acrosome contents during fertilization?

- Fetus is very active

- Fetal movement may be visible through abdominal wall

- Level of hCG hormone decline

- The corpus luteum deteriorate

- Placenta secretes progesterone

The statements above show that the fetus is in _____________ stage.

For a bacterial culture, the rapid increase in the cell numbers occurs during

A DNA strand is a polymer with an information-rich sequence of nucleotides where as

I the sequence of bases specifies the amino acid

sequence of a particular protein.

II monomers consists of deoxyribose sugar covalently

bonded to a phosphate group and a nitrogenous base.

III nucleotides are connected by phosphodiester linkages

to form a sugar phosphate backbone from which the

nitrogenous bases project.

Which of the following describe prokaryotic and eukaryotic cells?

I Both type of cells has plasma membrane.

II Both type of cells possess membrane enclosed

organelles.

III Prokaryotic cells lack of nucleus while eukaryotic

cells possess nucleus

Which of the followings statements are TRUE about plant and animal cells?

I Animal cells have a cell wall, nucleus and lysosome.

II Plant cells have a cell wall, central vacuole and cell sap.

III All cells have cytoplasm, cell membrane, mitochondria,

nucleus and chromosomes.

Which of the following statements are TRUE?

I Meiosis occurs in the testis and ovary.

II Meiosis occurs in the bone marrow, basal layer of the

skin and growth tissue.

III Mitosis is important for genetic stability, growth, cell

replacement and regeneration.

In fruit flies, the allele for ebony (n) is recessive to the allele for normal body (N). Complete the Punnett square for a cross between normal heterozygous flies.

I n

II NN

III Nn

Which of the following are TRUE of genetic code

I A sequence of three bases is needed to specify one

amino acid.

II More than one triplet can encode the same amino acid

III All 64 codons are used to encode the 20 amino acid.

Which of the following are TRUE about nondisjunction?

I (n + 1) gamete is a result of nondisjunction.

II Nondisjunction may occur during anaphase II.

III A process whereby chromosomes fail to separate

during meiosis.

Why, instead of the original DNA, is the human cDNA used for combining with a plasmid vector in some cloning processes?

I The original DNA contains exons and introns

II cDNA does not contain introns

III Bacteria cannot process introns

Which of the following hormones are secreted by the placenta?

I Oxytocin

II Estrogen

III Prostaglandin

Which of the following human characteristics can be shown by normal distribution curve?

I Height

II Body weight

III Fingerprints