WorksheetsSB015 MCQ SK
Total questions: 40
Worksheet time: 41mins
Which of the following statement is TRUE about lipids?
Phospholipids have hydrophilic tails and hydrophobic heads.
Glycerol, a building molecule of triglyceride is soluble in water.
Fatty acid consists of a short hydrocarbon chain with a-OH group at one end.
Saturated fatty acid have double bond while unsaturated fatty acid has no double bond between the carbon atoms.
According to the Fluid Mosaic Model, proteins of the membrane are
Embedded in a lipid bilayer.
Confined to the hydrophilic region.
Confined to the hydrophobic region.
Spread over in the inner and outer surfaces.
Transport across membrane that is against the concentration gradient is known as
osmosis.
diffusion.
active transport.
passive transport.
A cell in the basal layer of the skin contains 46 chromosomes and divides by mitosis to produce new skin cells. After ten successive divisions, how many chromosomes will the basal cell have?
23
24
46
48
Short horn (S) in cows is dominant to long horn, while black coat (B) is dominant to brown coat. Cows that are heterozygous for both characteristics were test crossed and produced 100 offspring. How many offspring would have short horn and black coat?
100
75
50
25
Night blindness is a condition in which the affected individuals have difficulty seeing in dim light. The allele for night blindness is recessive. A couple who are both carries for this gene have three children who have night blindness. What is the probability that their next child will be a carrier?
0
1/4
1/2
1
Which is the possible term used to describe the phenomenon when a red-flowered snapdragon is crossed with a white-flowered snapdragon plant producing a pink-flowered progeny?
Epistasis
Codominance
Complete dominance
Incomplete dominance
Determine the sequence of genes along a chromosome based on the following recombination frequencies:
A – B, 8 map units ; A – C, 28 map units ;
A – D, 25 map units; B – C, 20 map units;
B – D, 33 map units.
A – D – B – C
B – A – D – C
C – D – B – A
D – A – B – C
According to Hardy-Weinberg law, genetic equilibrium is achieved when
The population size is small
There is migration of genes
There is random mating
There is mutation
A population in Hardy-Weinberg equilibrium,16% of the individuals show the recessive traits. What is the frequency of the dominant allele in the population?
0.84
0.36
0.6
0.4
1. Which of the following is the CORRECT sequence of enzyme use for the synthesis of the lagging DNA strand after the formation of a replication bubble?
1. Ligase 2. Helicase 3. Primase
4. DNA polymerase
2 - 3 - 4 -1
3 - 2 - 4 - 1
3 - 4 - 2 - 1
4 - 3 - 1 - 2
A sequence of DNA bases from a sense strand is given as
TACATGTTCGAGCATGTAACG
The mRNA codons for the respective amino acids are given below:
UAC – tyr CUC – leu CCU - pro
AAG – lys GUA – val AGU - ser
GAG – glu CAU – his GGC - gly
AUG – met UGC – cys GGA – arg
lys-glu-val-his-pro-arg-tyr
met-his-arg-cys-val-lys-ser
met-tyr-lys-leu-val-his-cys
val-lys-glu-ser-leu-tyr-lys
A mutation in the regulatory gene of an inducible operon of E. coli would result in
inactivation of RNA polymerase.
continuous structural gene transcription.
complete inhibition of structural gene transcription.
irreversible binding of the repressor to the operator.
Which of the following is TRUE about mutation?
Can be induced by ultraviolet rays.
Will not affect the base sequence of the DNA.
Does not change the genotype of an individual.
Can be inherited if it occurs in the epithelial cell.
Which of the following mutations have a harmful effect on an organism?
A single base-pair substitution.
A deletion of three bases in the middle of an intron in the gene.
A single base deletion close to the end of the last exon in the gene.
A single base deletion near the start of the first exon in the gene.
FIGURE 1 shows non-disjunction during meiosis of an organism. What will be the number of chromosomes for zygote if gamete P and Q fuse with normal gamete?
Fusion of gamete P with normal gamete = 3
Fusion of gamete Q with normal gamete = 5
Fusion of gamete P with normal gamete = 5
Fusion of gamete Q with normal gamete = 3
Fusion of gamete P with normal gamete = 7
Fusion of gamete Q with normal gamete = 9
Fusion of gamete P with normal gamete = 9
Fusion of gamete Q with normal gamete = 7
The table above shows the types of mutation and their examples.
Which of the following about the types of mutation and their examples is CORRECT?
P: I Q: II R: III S: IV
P: II Q: III R: IV S: I
P: II Q: IV R: I S: III
P: III Q: IV R: II S: I
Which statement BEST describes a recombinant DNA?
DNA which carries genes from different organisms.
DNA which results from bacteria conjugation.
DNA which is produced from crossing over.
DNA which is produced from a mutation.
Unpaired nucleotides produced by restriction enzymes at one end of DNA fragment is known as the
Blunt end
Sticky end
Restriction fragment
Single strand template
Which is the main reason that explains biotechnology has advanced rapidly until it can be applied to almost all aspects of human life?
Organisms could be manipulated to express foreign genes.
All organisms share the same basic genetic material, DNA, with an almost universal genetic code.
All organisms synthesize various organic molecules that could be isolated and used for a specific application.
Genetic engineers have the capacity to understand how living organism function at cellular and molecular levels.
DNA plasmid is shown in the diagram above. One of the steps in the production of recombinant bacteria capable of producing human insulin is the insertion of the insulin gene into the plasmid. Screening was done by culturing the bacteria in agarose medium containing ampicillin.
Which result shows that human insulin gene has been taken in by the bacteria cultured in ampicillin?
White colonies formed
No white colonies formed
Blue colonies formed
No blue colonies formed
What is the importance of restriction endonucleases in a bacterial cell?
It enables bacterial autolysis to occur.
It provides resistance against antibiotics.
It cuts viral DNA molecules into fragments.
It destroys antigens and neutralizes toxin.
Screening is
The process of choosing the clone which has undergone transformation.
The insertion of a foreign gene into a vector.
The process of producing a transgenic organism.
The insertion of a vector into a host cell.
FIGURE 2 shows reproductive stages of flowering plant. Identify process J and K.
J: Meiosis K: Mitosis
J: Mitosis K: Mitosis
J: Meiosis K: Mitosis
J: Mitosis K: Meiosis
Which of the following sequences of spermatogenesis is CORRECT?
Spermatogonium - Spermatid - Primary spermatocyte -Secondary spermatocyte - Sperm cell
Primary spermatocyte - Secondary spermatocyte -Spermatogonium - Spermatid - Sperm cell
Primary spermatocyte - Spermatogonium - Secondary spermatocyte - Spermatid - Sperm cell
Spermatogonium- Primary spermatocyte -Secondary spermatocyte- Spermatid - Sperm cell
FIGURE 3 shows a part of the seminiferous tubule. L, M, N and O represent cells in various stages of development. Choose the CORRECT statement.
L: Differentiate from somatic cells
N: Differentiate from germ cells
L: Has haploid number of chromosome
N: Has diploid number of chromosome
L: Undergoes meiosis to form structure M
N: Undergoes mitosis to form structure O
L: Undergoes mitosis to form structure M
N: Differentiate to form structure O
The following are the consequences when ovaries are removed from a cancer patient EXCEPT
Not able to breastfeed a baby.
No menstruation and ovulation cycles.
No secretion of estrogen and progesterone
The secretion of LH and FSH will be declined.
Which of the following is a function of the acrosome contents during fertilization?
Block polyspermy.
Digest the exterior coats of the egg.
Nourish the mitochondria of the sperm.
Trigger the completion of meiosis in secondary oocyte
- Fetus is very active
- Fetal movement may be visible through abdominal wall
- Level of hCG hormone decline
- The corpus luteum deteriorate
- Placenta secretes progesterone
The statements above show that the fetus is in _____________ stage.
trimester I
trimester II
trimester III
final trimester
For a bacterial culture, the rapid increase in the cell numbers occurs during
Lag phase.
Mid exponential growth.
Last stages of exponential growth.
Early stages of exponential growth.
A DNA strand is a polymer with an information-rich sequence of nucleotides where as
I the sequence of bases specifies the amino acid
sequence of a particular protein.
II monomers consists of deoxyribose sugar covalently
bonded to a phosphate group and a nitrogenous base.
III nucleotides are connected by phosphodiester linkages
to form a sugar phosphate backbone from which the
nitrogenous bases project.
I and II only
I and III only
II and III only
I, II and III
Which of the following describe prokaryotic and eukaryotic cells?
I Both type of cells has plasma membrane.
II Both type of cells possess membrane enclosed
organelles.
III Prokaryotic cells lack of nucleus while eukaryotic
cells possess nucleus
I and II only
I and III only
II and III only
I, II and III
Which of the followings statements are TRUE about plant and animal cells?
I Animal cells have a cell wall, nucleus and lysosome.
II Plant cells have a cell wall, central vacuole and cell sap.
III All cells have cytoplasm, cell membrane, mitochondria,
nucleus and chromosomes.
I and II only
I and III only
II and III only
I, II and III
Which of the following statements are TRUE?
I Meiosis occurs in the testis and ovary.
II Meiosis occurs in the bone marrow, basal layer of the
skin and growth tissue.
III Mitosis is important for genetic stability, growth, cell
replacement and regeneration.
I and II only
I and III only
II and III only
I, II and III
In fruit flies, the allele for ebony (n) is recessive to the allele for normal body (N). Complete the Punnett square for a cross between normal heterozygous flies.
I n
II NN
III Nn
I and II only
I and III only
II and III only
I, II and III
Which of the following are TRUE of genetic code
I A sequence of three bases is needed to specify one
amino acid.
II More than one triplet can encode the same amino acid
III All 64 codons are used to encode the 20 amino acid.
I and II only
I and III only
II and III only
I, II and III
Which of the following are TRUE about nondisjunction?
I (n + 1) gamete is a result of nondisjunction.
II Nondisjunction may occur during anaphase II.
III A process whereby chromosomes fail to separate
during meiosis.
I and II only
I and III only
II and III only
I, II and III
Why, instead of the original DNA, is the human cDNA used for combining with a plasmid vector in some cloning processes?
I The original DNA contains exons and introns
II cDNA does not contain introns
III Bacteria cannot process introns
I and II only
I and III only
II and III only
I, II and III
Which of the following hormones are secreted by the placenta?
I Oxytocin
II Estrogen
III Prostaglandin
I and II only
I and III only
II and III only
I, II and III
Which of the following human characteristics can be shown by normal distribution curve?
I Height
II Body weight
III Fingerprints
I and II only
I and III only
II and III only
I, II and III
