Worksheets● End-of-chapter 1 questions
Total questions: 30
Worksheet time: 30mins
Polymers of polysaccharides, fats, and proteins are all synthesized from monomers by:
Connecting monosaccharides together
The addition of water to each monomer
The removal of water (dehydration synthesis)
Ionic bonding of the monomers
The formation of disulfide bridges between monomers
Rachel is analyzing a DNA sample to identify its base pairs. Her results show that 40% of the sample is adenine. Which other base makes up 40% of the sample?
Cytocine
Thymine
Uracil
Guanine
The following sequence in registered in a genomic data bank as part of a coding locus in a genome: 5'.....AGGAGGTAGCACCTTTATGGGGAATGCATTAAACA.......3'.
The ATG underlined represents the initiation codon of the gene located at that locus. Among the following sequences, which one could be part of the transcribed mRNA corresponding to that locus?
A. 5' AGGAGGUAGCACCUUUAUGGGGAAUGCAUUAAACA 3'.
5' UCCUCCAUCGUGGAAAUACCCCUUACGUAAUUUGU 3'.
5' ACAAAUUACGUAAGGGGUAUUUCCACGAUGGAGGA 3'.
5' UGUUUAAUGCAUUCCCCAUAAAGGUGCUACCUCCU 3'.
The following sequence of letters represents the order of bases in a single strand of DNA C-T-T-A-G-G-C-T-T-A-C-C-A. Which of these sequences would be the complementary strand that forms during replication?
G-A-A-T-C-C-G-A-A-T-G-G-T
C-T-T-A-G-G-C-T-T-A-C-C-A
T-C-C-G-A-A-T-C-C-G-T-T-G
A-G-G-C-T-T-A-G-G-C-A-A-C
Uracil is inserted between the 9-th and 10-th base (counting in 5 - 3 direction) of the following mRNA: 5' GCUAUGCGCUACGAUAGCUAGGAAGC 3’ and when it is translated into a peptide, the length of the peptide chain is:
4
5
8
9
Which of the following is true for RNA?
G + С = A + U.
G + С = С + U;
G + С > A + U.
none of the above.
If the following DNA is transcribed in the direction shown. The RNA product will be:
5' U С G G С G A A U G С 3'
5 ' G C A U U C G C C G A 3 '
5' С G U A A G С G G С U 3'
5' A G С С G С U U А С G 3'.
When the base composition of DNA from bacterium Mycobacterium tuberculosis was determined, 18 percent of the bases were found to be adenine. What is the [G] + [C] content?
18%
32%
36%
64%
If you extract the DNA of the bacteriophage (X174, you will find that its composition is 25 % A, 33 % T, 24 % G, and 18 % C. How would you interpret these results?
the experiment’s results must be erroneous; something went wrong.
DNA is double stranded and replicates semi-con- servative.
as the A and T, respectively C and G percentages are different, DNA is single - stranded;
because A does not equal T, nor does G equal C, the DNA must be single stranded;
Messenger RNA was transcribed in vitro from a double-stranded DNA molecule, which was later separated into single strands. For each strand of the DNA, the base ratio was analyzed and compared with that of mRNA. On the basis of the data given in the table, which strand of the double-stranded DNA served as the template for the mRNA synthesis?
DNA-l
DNA-2
DNA-3
DNA-4.
The following table shows the percentages of nucleic acid bases, isolated from different species.
species (1), (2) and (3) carry DNA as the genetic material;
species (4) and (5) carry RNA as the genetic material;
species (1) and (2) have double-stranded DNA;
species (3) has single-stranded DNA;
species (4) and (5) have double-stranded and single-stranded RNA respectively.
Which of the following biological macromolecules is correctly paired with one of its functions?
Lipids ⟶ give quick energy to cells
Nucleic acids ⟶ digest dead cells
Proteins ⟶ provide cell structure
Carbohydrates ⟶ store genetic information
What are the repeating subunits that make up a nucleic acid?
Monosaccharides
Glycerol and fatty acid tails
Nucleotides
Amino acids
What are the three components of a genetic molecule?
A phosphate group, pentose sugar, and nitrogenous base
Sucrose, Fructose, and Lactose
A phosphate group, Pentose Sugar, and Oxygen base
A Carbon Group, Pentose sugar, and Oxygen Base
Monomer of nucleic acids; consists of a phosphate group, deoxyribose (sugar), and a nitrogen-base. ATP is an example of this.
polypeptide
nucleotide
polymer
steroid
The size of the nucleotides ensures that Adenine always pairs with (a)
(a) is the RNA that carries information from DNA to the ribosome
Primary structure is the sequence of (a) in a polypeptide or protein.
Amino acids link together by the loss of a molecule of water to form a (a)
Proteins contain carbon, hydrogen, oxygen and (a) , and many contain sulfur.
An (a) fatty acid has one or more double bonds, with one fewer hydrogen atom on each double bonded carbon.
(a) are made by condensation between three fatty acid molecules and glycerol.
When many glucose molecules are joined together, the carbohydrate is called a (a)
The (a) molecule is made up of hundreds of glucose molecules joined together to form long chains. That is an important storage substance in the plastids of plant cells.
(a) is a polysaccharide that forms a food storage substance in many animal cells
(a) consists of even longer chains of glucose molecules. The chain molecules are grouped together to form microscopic fibres, which are laid down in layers to form the cell wall in plant cells.
Sugars with a single carbon ring are called (a)
Monosaccharides and disaccharides are readily (a) in water.
Which of the following categories includes all others in the list?
starch
carbohydrate
polysaccharide
disaccharide
Which statement about unsaturated fats is true?
They are more common in animals than in plants.
They have double bonds in their fatty acid chains.
They generally solidify at room temperature.
They contain more hydrogen than do saturated fats havingthe same number of carbon atoms.
