Font size
WorksheetsForensic Science - Final Review
Total questions: 20
Worksheet time: 17mins
The caliber of a bullet is determined by the / O calibre de uma bala é determinado pelo ______.
diameter / diâmetro
height/ altura
velocity / velocidade
What is the role of "land and grooves" [rifling] in a firearm?/ (2 right answers!)
Qual é o papel dos "land e grooves" [rifling] numa arma de fogo? (2 respostas certas!)
allows the bullet to travel farther/
para fazer o projétil ir mais longe
helps load the bullet into the barrel/
ajuda a carregar a bala no cano
to make the bullet rotate more accurately/
para fazer a bala girar com mais precisão
ejects the cartridge from the firearm/
ejetar o cartucho da arma de fogo
What is the main difference between a shotgun and rifle? /
Qual é a principal diferença entre uma espingarda e um rifle?
Um rifle tem um cano liso, enquanto uma espingarda tem um cano estriado com (land e grooves).
Uma espingarda tem um cano liso, enquanto um rifle tem um cano estriado com "land e grooves".
If a person's blood contains both the B and O proteins, then they CANNOT receive which blood type? (multiple answers)
Se o sangue de uma pessoa contém proteínas B e O, então NÃO PODEM receber qual tipo de sangue?
(várias respostas)
AO
AB
BO
OO
The image shows agglutination (clumping) occurring in wells A and B of a patient’s blood sample. This means that this patient will have blood type __.
A imagem mostra aglutinação (aglomeração) ocorrendo nos poços A e B da amostra de sangue de um paciente. Isso significa que esse paciente terá tipo sanguíneo __.
A
B
AB
OO
Which of the blood drops was dropped from the highest location?
/ Qual das gotas de sangue caiu do local mais alto?
B
C
E
F
Com base nas suas respostas anteriores, podemos concluir que geralmente, o diâmetro da mancha de sangue ____ à medida que a altura aumenta.
diminui
continua sem alteração
aumenta
aumenta no sentido do comprimento, diminui no sentido da largura
During the process of DNA extraction, the point of PCR amplification is to... /
Durante o processamento do DNA, o objetivo da amplificação PCR do DNA é
aumentar a quantidade de DNA na amostra.
classificar o DNA por tamanho.
estourar a célula
isolar o DNA para flutuar no topo da solução
What are the steps of the DNA analysis process in order?
Quais são as etapas do processo de análise de DNA em ordem?
1. Gel Electrophoresis
2.DNA Extraction and Isolation
3.PCR and STR analysis
1.DNA Extraction and Isolation
2.Gel Electrophoresis
3.PCR and STR analysis
1.DNA Extraction and Isolation
2.PCR and STR analysis
3.Gel Electrophoresis
DNA analysts have to cut DNA to look at specific sequences in which humans display differences.
To cut the DNA, analysts will use...
/
Os analistas de DNA precisam cortar DNA para observar sequências específicas em quais os humanos apresentam diferenças. Para cortar o DNA, analistas usarão...
gel electrophoresis. / Eletroforese em gel.
soap or cell lysis solution/
sabão ou solução de lise celular
restriction enzymes. / Enzimas de restrição.
alcohol /álcool
In the picture above, the smallest fragment of DNA can be found ________.
Na imagem acima, o menor fragmento de DNA pode ser encontrado ________.
Towards the beginning of the gel electrophoresis machine or near the wells. /
No início da máquina de eletroforese em gel ou próximo aos poços.
Towards the bottom part of the get electrophoresis machine. /
Na parte inferior da máquina de eletroforese.
Which of the following would be considered an entry wound?
Qual e a ferida da entrada?
A
B
A bloodstain that impacts a surface at a low surface angle will have a shorter tail than one that impacts at a higher angle.
/
Uma mancha de sangue que impacta uma superfície em um ângulo baixo terá uma cauda mais curta do que aquela que impacta em um ângulo mais alto.
True / Verdadeiro
False / Falso
What part of the gun is shown in (A)?
Que parte da arma é mostrada em (A)?
Firing Pin
Pino de disparo
Cartridge Case
Estojo de cartucho (balas)
Magazine
Rifling inside the barrel
Marcas dentro do cano
(lands and grooves)
What (part of the gun) left a mark on the centerfire bullet?
Qual (parte da arma) deixou uma marca nesta bala de fogo central?
muzzle
(boca)
firing pin
(pino de disparo)
trigger
(gatilho)
hammer
(martelo)
Which direction did the blood drop come from?
De que direção veio a gota de sangue?
A
B
C
D
Abbreviate the STRs (short tandem repeats) found in the sample DNA strand:
Abrevie as STRs (repetições curtas em tandem) encontradas na fita de DNA:
CCACACAGGTAATGAATGAATGAATGCCTAAGTGCC
[GAAT]5
[GAAT]2
[GAAT]4
[GAAT]3
Suppose a mother has the STR genotype of 8,8 and the dad has the STR genotype of 8, 8.
Both parents would be considered...
Suponha que a mãe tenha o genótipo STR de 8,8 e o pai tenha o genótipo STR de 8,8.
Ambos os pais seriam considerados...
homozygous
homozigoto
heterozygous
heterozigoto
A victim has the blood type BO. A couple has (mom: AB) and (dad: AO).
Is it possible that the victim is their daughter?
Uma vítima tem o tipo sanguíneo BO. Um casal tem (mãe: AB) e (pai: AO).
É possível que a vítima seja filha deles?
No
Nao
Yes
Sim
Scientists are studying a case that involved a swinging hammer and a stomach wound. Which blood splatter pattern is the one from a swinging hammer?
Cientistas estão estudando um caso envolvendo um martelo balançando e um grande ferimento no estômago da vítima. Qual padrão de respingos de sangue é causado por um martelo?
A
B
