A climber feels short of breath and dizzy due to lack of oxygen after being at a certain altitude while climbing a mountain. What pathophysiology is the climber experiencing?

What are the signs of spots on a baby's back?

Which physical examination type is not routinely performed on a baby?

One sign of oxygen deficiency in the extremities that can be observed over a long period is...

In a patient with trauma, weak pulse, what plays a role in the decrease of pulse?

The doctor asks the patient to lie in a lateral position on the left decubitus, then the doctor asks for permission to perform an examination of the anus, what can be assessed from this examination?

A patient experiences prostate enlargement. What is the appropriate physical examination?

A patient is experiencing prostate enlargement. What is the appropriate physical examination?

The presence of metallic sound during abdominal auscultation indicates...

The characteristics that can be found during liver palpation in a patient with hepatitis are...

A doctor should be concerned about the risk of malnutrition in a patient if...

A male baby weighing 3000 grams is born spontaneously to a primigravida mother, aged 17, at 38 weeks of pregnancy. The baby is born without crying. After resuscitation at the fifth minute, the baby is found to have a strong cry, heart rate of 120 beats per minute, cyanosis at the extremities, active movement, and a strong cry during suction. What is the APGAR score at the fifth minute for this baby?

A patient with a BMI of 30 requests vitamins/supplements. What should a doctor do?

DNA analysis to determine the presence of SNP CYP2C19 at nucleotide position 641 (allele*3) is performed by amplifying DNA with PCR followed by RFLP. The forward and reverse primers used can amplify a DNA segment of 324 base pairs. The presence of polymorphism will result in the formation of a recognition site for the restriction enzyme AluI, so that the amplified segment of 324 bp will be cut into 210 bp and 114 bp. If both alleles at nucleotide position 641 experience polymorphism, what will the electrophoresis image look like?

A 8-year-old child is brought to the clinic due to difficulty in gaining weight. The mother is worried that the child may fall into a state of malnutrition. At what percentage of weight-for-height does the child fall into a state of malnutrition?

The reference point for measuring JVP is...

A child aged 8 years with decreased consciousness is suspected to have bacterial meningitis. The neurological examination to see if there are any meningeal irritation signs is...

The ability to resist infections attacking...

The system that is disrupted in a child with incomplete immunization and appears with red spots?

A soldier is stationed in a desert area. The heat transfer that occurs in that soldier's area is...

The anterior axillary line is...

If in the case of Mr. Harun it is known that in the sequence of DNA GACTTGTTTTCAATTGCGCTTAATT, there is a polymorphism substitution of Alanine (A) to Guanine (G), to find out about the polymorphism using the RFLP method, using the restriction enzyme the polymorphism is known by the restriction enzyme...

The general form used for nutritional screening is...

The mid-sternal line is...

Which includes additional breath sounds is...

Yang termasuk suara nafas tambahan adalah...

Linea Midclavicularis adalah...

Pernyataan yang paling tepat untuk menggambarkan diet adalah...

Tn. A mengalami sakit di abdomen pada bagian bawah, regio tempat sakitnya dibatasi garis apa saja?

Tampilan perut pada penderita malnutrisi, yaitu berbentuk...

Seorang laki-laki usia 25 tahun datang ke UGD RS dengan keluhan penurunan kesadaran dan kejang sejak 1 hari yang lalu. Pasien baru pulang dari Papua sejak 1 minggu yang lalu. Pada pemeriksaan sediaan hapus darah tepi didapatkan gambaran seperti dibawah ini. Bagaimanakah klinis demam yang terjadi pada kasus?

Seorang anak 5 tahun dibawa berobat oleh ibunya untuk pemeriksaan rutin. Anamnesis pada anak yang berbeda dengan anamnesis pada orang dewasa adalah...

Seorang anak dengan diare dibawa berobat oleh ibunya karena sangat lemas. Data apa saja yang diperlukan untuk memperkirakan kehilangan cairan?

Seorang wanita, 45 tahun, datang dengan keluhan badan lemas sejak 3 hari yang lalu. Pasien juga mengeluh kepala pusing. Demam tidak ada. Dari riwayat menstruasi didapatkan menstruasi pasien memanjang, lebih dari 7 hari dan pasien ganti pembalut 4 sampai 5 kali setiap kali menstruasi. Dari pemeriksaan laboratorium didapatkan Hb pasien 9,2 g/dl. Dari pemeriksaan ekstremitas atas didapatkan...

A 30-year-old woman presents with red, painful, itchy, and watery eyes. She also has had a yellowish discharge, fever mainly at night, and has experienced weight loss. She has a previous diagnosis of pulmonary TB. Based on the examination, what is the condition of the eye that corresponds to the image?

A male infant weighing 3000 grams is born via spontaneous delivery to a primigravida mother aged 17 years, who is 38 weeks pregnant. The birth weight of the infant is 1600 grams. Based on the birth weight, what is the diagnosis for this infant?

Mr. Harun, aged 50, experienced an acute myocardial infarction after having received clopidogrel to prevent thrombus formation. Upon examination, the level of clopidogrel in the serum was found to be low. If there is suspicion of polymorphism, which gene should be examined?

A 45-year-old man presents to the emergency department with severe anxiety, shortness of breath, and a cough that started 4 hours ago. The doctor diagnoses him with acute pulmonary edema. What type of cough is likely occurring in this case?

A 25-year-old man presents to the emergency department with decreased consciousness and seizures for the past day. He just returned from Papua a week ago. Upon examination, a blood smear shows the following image. What is the clinical stage of the disease in this case?

A 66-year-old man presents to the emergency department with complaints of weakness and after further questioning, it is revealed that he has had diarrhea more than 10 times, resembling watery stools for the past 2 days. Upon physical examination, a sunken eye is noted. What physical examination finding is most likely to be found in this patient who is experiencing severe dehydration?

A 5-year-old child is brought by his mother for a routine check-up. The anamnesis in children differs from that in adults in that...

A 29-year-old woman comes with complaints of frequent palpitations, sweating on her palms, anxiety, increased appetite but feeling weight loss. The patient often feels hot and prefers to be in a cool place. The condition of the eye related to this patient's condition is?

A 5-year-old child comes to the hospital accompanied by his parents. During the doctor’s anamnesis regarding the patient's illness, information is obtained from the child's mother that the complaints experienced by the patient have been present for 4 days. The patient is found to have red spots on the skin and feels itchy. In addition, the child's mother explains that before the child was here, they had eaten at a roadside restaurant a few days ago. The doctor then conducts additional anamnesis by asking the child's mother whether the child has had allergies to certain foods or substances, and the mother answers that the child has previously experienced allergic reactions to peanuts when the patient was 3 years old. What type of anamnesis is obtained?

A 20-year-old woman comes with complaints of pain throughout her body. The patient also feels pain in her arms and legs for 30 minutes after waking up. The patient also complains of swelling in her wrists and ankles. There are no sores, hair loss is not present, and fever is not rising. The examination of the upper extremities that corresponds to the above condition is?

A male baby weighing 3000 grams is born spontaneously to a 17-year-old primigravida mother, 38 weeks pregnant. The baby is born and does not cry immediately. After resuscitation is performed at the fifth minute, a strong cry is obtained, heart rate 120 beats per minute, cyanosis in the extremities, active movement, and a strong cry during suction. What is the APGAR score at the fifth minute for this baby?

A 35-year-old man comes with complaints of seizures throughout his body for 5-10 minutes since 1 hour ago. Before the seizure, the patient complained of stiffness and cramps in the neck, tingling in both legs, and twitching in both cheeks. The patient is known to have a history of total thyroidectomy 1 year ago, and since then the patient has been diagnosed with hypoparathyroidism. The physical examination of the face related to this patient's clinical condition is...

When on duty at the clinic, there are 2 children with the same name. For patient safety, the most appropriate data to ask so that there is no mistake in providing treatment to the patient is...

A woman, 35 years old, was brought to the emergency room after a traffic accident. The patient suffered from a fairly severe injury and had to immediately undergo surgery. When the patient arrived, the doctor immediately explained the patient's current condition to her parents in detail and used medical terms in his explanation, then immediately provided informed consent to the patient before performing the surgery. What is the doctor's inappropriate attitude in this case?

A mother brings her child to the doctor because the child's weight has not increased. The mother and child come from a lower-middle-class family. She asks for the child to be given appetite-enhancing vitamins. The health center then provides her with multivitamins. What could hinder the management of this case?

The influence of polymorphism on the CYP2C19 gene is known to affect the response to treatment if several drugs that are substrates of this enzyme isoform are given. Which drug is a substrate of the CYP2C19 enzyme?

Using narcotic injections. From the oral inspection, the tongue appears as shown in the image below; the appearance of the tongue that corresponds to the image is...

A boy is brought in with suspected diabetic ketoacidosis. The breathing pattern that can be found in patients with ketoacidosis is...

The human body is composed of various organs that then have similar functions to form an organ system. What system functions as a regulator?

Fenti has a problem with sneezing. What is the name of the organ that is likely experiencing this problem?

A 7-year-old child with edema. What examination should be performed to detect ascites?

Which organ converts angiotensinogen into angiotensin?

What is the most likely etiology for the patient with liver enlargement and other symptoms?

What is the level of consciousness in this patient who has been unresponsive to stimuli?

What is the finding of thrill in a patient after heart surgery caused by...

What is the normal breath sound heard at the parasternal line?

What is the maneuver to flex the hip and knee while lying down?

What is the normal percussion sound in the thorax (excluding heart and liver)?

What are the clinical signs in a case of a 45-year-old man with abdominal pain and fever?

What should be considered when measuring blood pressure in an 8-year-old child with kidney disease?

What organ system is affected in an 18-year-old student with jaundice?

What organ system is experiencing issues based on the main complaint of the case above according to SKDI 2012?

What is the possible organ affected by a woman aged 54 who has been experiencing small bowel movements resembling goat feces for the past 6 months?

What important data should be asked from the mother to find the possible cause of the congenital anomaly suspected in a child with a history of red urine?

What examination should be performed to determine the presence of polymorphism in a patient who has been taking clopidogrel to prevent thrombus formation?

What should the doctor do to ensure an accurate diagnosis for a 30-year-old patient who has been experiencing non-healing ulcers for the past 6 months and is suspected of having diabetes mellitus?

What amino acid at position 389 plays a role in the phenomenon of a hypertensive patient who does not show significant blood pressure reduction despite using metoprolol?

What is the Linea Sternalis?

What is the Linea Parasternalis?

What is the Linea Parasternalis?

What is the diagnosis for a male infant weighing 3000 grams, born to a 17-year-old primigravida mother at 38 weeks of gestation, who is hypothermic?

What physical examination finding can be found in a 34-year-old male patient with fever and other symptoms?

What is the possible diagnosis for a male infant weighing 3000 grams, with an APGAR score of 8 at 1 minute and 9 at 5 minutes, who is referred for blood in the stool?

What should be included in the developmental history of a 2-year-old child during a routine examination?