WorksheetsUnit 6: Genetics and Biotechnology Quiz
Total questions: 101
Worksheet time: 2hrs 9mins
A tomato gene, known as the SIKLUH gene, has recently been discovered. The gene leads to the production of larger tomatoes. The gene affects fruit size by increasing cell layers and promoting extra cell divisions. In order to produce large fruit in other commercial plant species, scientists might
clone the genes of other types of plants until they develop larger fruits
breed the tomatoes with other fruits such as apples
insert the gene into other types of plants
stimulate the process of meiosis in the other plants
Which activity enables humans to produce new genetic combinations in other organisms?
selecting and breeding the organisms for specific traits
increasing the number of enzymes available to the organisms
growing organisms that reproduce asexually
decreasing the amount of DNA in the diet of the organisms
Farmers may someday clone their best milk producing cow into a whole herd. What potential disadvantage might be important to consider in having such a large group of clones on one farm?
It may be difficult to tell the animals apart.
Lack of variation may limit survival in the herd
The cows could be fertilized by only one type of bull.
The cows could be mated only with each other.
A farmer wanted to rid his apple trees of a particular leaf-eating insect. He sprayed his trees with an insecticide that killed 98% of the insects. The survival of 2% of this population of insects is most likely due to
genes obtained from another species
certain chemicals that stimulated overproduction
variations that resulted from sexual reproduction
their ability to produce food from the pesticide
Potato farmers in Ireland during the mid 1800s all grew the same type of potato. The potato plants were all produced as clones of one another. When a fungus infected the crop, all of the potatoes were destroyed. This occurred because these potato plants
had little genetic variability
had increased biodiversity
were the product of fertilization
were the result of biotechnology
The corn we eat today is larger and has more kernels than the corn people first grew thousands of years ago. Which process is most likely responsible for the changes that have occurred?
mitosis
succession
direct harvesting
selective breeding
A mutation occurring in a human can be passed from parent to offspring when it occurs in a
lung cell, due to exposure to a toxic gas
gamete formed in the ovary
body cell undergoing mitosis
heart cell with chromosome damage
A homozygous dominant dog with brown fur is crossed with a heterozygous dog with brown fur. What are the percentages of the possible genotypes?
100% BB
75% BB and 25%Bb
50 % BB and 50% Bb
50% Bb and 50% bb
Characteristics that are inherited.
traits
genetics
heredity
genotype
The ______ trait is hidden by the ______ trait.
recessive/dominant
dominant/recessive
heterozygous/homozygous
homozygous/heterzygous
The parents of a new baby believe they brought the wrong child home from the hospital. Gel electrophoresis was performed using DNA samples from the parents and the child. A section of the gel
electrophoresis results is shown below. Which conclusion is valid based on the gel electrophoresis results?
They have the correct child, because her genetic information is identical to that of the father.
They have the wrong child, because her genetic information does not match that of either parent.
They have the correct child, because her genetic information came from both parents.
They have the wrong child, because her genetic information matches only that of the mother.
Plant A and Plant B are the same species. Plant A is given water daily and plant B is only given water once a week. Plant A grows to 10 cm tall after 3 weeks and Plant B only grows to 4 cm tall after 3 weeks. This is the result of:
Better genes in plant A
Better genes in plant B
Environmental factors
Environmental consistancy
Sally Mae was entering the science fair. She wanted to test the effect of sunlight on the color of a plants leaves. Her first plant was placed in a dark room, her second plant was allowed 3 hours of light a day and the third plant was given 6 hours of light a day. The color of the leaves varied in shades of green - lightest (no light plant) to brightest green (6 hour light plant). What is the best reason?
Each plant had different genes that controlled the color of the leaves
There was a genetic mutation affecting leaf color
The expression of the gene that controls chlorophyll production was affected by the environment
It cannot be concluded since she did not run a proper scientific experiment.
The environment will affect how your genes are expressed.
True
False
In preparation for an electrophoresis procedure, enzymes are added to DNA in order to
convert the DNA into gel
cut the DNA into fragments
change the color of the DNA
produce longer sections of DNA
This laboratory procedure is known as
CLONING
gel electrophoresis
chromatography
use of a dichotomous key
What is this technique an example of?
chromatography
gel electrophoresis
direct harvesting
genetic engineering
Sample 1: ATTCCGGTAATCCCGTAATGCCGGATAATACTCCGGTAATATC
Sample 2: ATTCCGGTAATCCCGTAATGCCGGATAATACTCCGGTAATATCThe results of DNA analysis are often used to help determine
the number of DNA molecules in an organism
if two species are closely related
the number of mRNA molecules in DNA
if two organisms contain carbohydrate molecules
The arrows in the diagram below indicate the development of four different varieties of vegetable plants from wild mustard.Each of these varieties was most likely produced as a result of
asexual reproduction in the wild for many years
changes in light availability
competition between plants
selective breeding over many generations
Why do offspring usually look like their parents?
Their parents choose their features and make sure they look similar to themselves.
The offspring adapt to their surroundings making them look more like their parents
Offspring receive characteristics that have been passed down from their parents
ATG GGA ACT CCA
ATG TGA CAG
A change in a DNA sequence is called a
codon
anticodon
mutation
triplet
What base does RNA have that DNA does not?
uracil
thymine
cytosine
guanine
