Font size
WorksheetsIB Genetics, Mitosis, & Meiosis ~ Corona Refresher!
Total questions: 70
Worksheet time: 6hrs 34mins
Suhitha is blood type B and Kieran is blood type A. How can they have children who are types A, B, AB, and O?
Suhitha: IBIB
Kieran: IAIA
Suhitha: IBIB
Kieran: IAi
Suhitha: IBi
Kieran: IAi
Suhitha: IBi
Kieran: IAIA
What phase is shown in the picture during meiosis?
anaphase 1
anaphase 2
metaphase 1
telophase 1
Identify the phase of meiosis.
Metaphase I
Metaphase II
Prophase I
Anaphase II
Which phase?
Metaphase I
Metaphase II
Anaphase I
Anaphase II
What is the purpose of PCR?
To produce millions of copies of DNA.
To produce millions of copies of a specific region of DNA
To add nucleotides to a DNA sequence
To watch polymerase work.
What does PCR stand for?
Polymerase Cytoplasmic Reaction
Polymerase Chromosomal Reaction
Polymerase Chain Reaction
Probably Cannot React
What happens in the Denature step of PCR?
The DNA nucleotides are broken apart.
The base-pairing rules for DNA are reversed.
The double-stranded DNA is separated into two single strands of DNA.
The DNA is returned to its natural setting.
What happens during the Anneal step of PCR?
Primers are created.
The primers attach to the target DNA region.
Primers copy the new DNA strand.
Primers sequence DNA
What is the function of a primer?
To identify the particular region of DNA to be copied by PCR.
To copy DNA.
To create DNA nucleotides.
To maintain the temperature of the PCR reaction.
If the target sequence is GCATTA, what is the complementary sequence?
TACGGC
CGTAAT
GCATTA
ATGCCG
What is a restriction enzyme?
Enzyme that cuts DNA
Enzyme that add to the DNA strand
Enzyme that builds proteins
Enzyme that breaks down lipids
Asymetrical ends of DNA after being cut by a restriction enzyme
Competent Ends
Sticky Ends
Ligated Ends
Restrictive Ends
From where does Taq polymerase come?
Bacteria that live in hydrothermal vents/hot springs.
Pig cells
The rain forest
The CDC
What are the uses of PCR?
Cloning
Paternity Testing
Genotyping
DNA Profiling
Based on these results whose blood was found in the blood stain at the crime scene?
Bob
Sue
John
Lisa
DNA is recovered from a dead soldier who was so badly injured she could not be formally identified. Which parents have lost their child?
Parents C and D
Parents E and F
Parents A and B
Parents G and H
Why do the fragments of DNA in gel electrophoresis travel away from the negative electrode?
DNA is negatively charged so attracted to the positive end of the unit
DNA is positively charged so is attracted to the negative end of the unit
the agarose gel is negatively charged
the agarose gel is positively charged
In gel electrophoresis, the largest DNA fragment will appear....
closest to the starting wells
farthest from the starting wells
three quarters away from the starting wells
it depends on how many fragments there are
Restriction Enzymes . . .
cut DNA at precise locations
help bacteria to pick up DNA
move DNA through a gel
copy DNA
Why do bacteria have restriction enzymes?
To prevent them from being infected by viruses
To help them get DNA into their cell
Restriction enzymes are an essential enzyme needed during replication
To cut their DNA into more manageable fragments
What shape are plasmids?
linear
circular
double helix
they are various shapes
Gel electrophoresis enables scientists to.....
separate DNA fragments.
combine DNA fragments.
count the genes in DNA
insert DNA in cells
Restriction Enzyme HamIL1 reads AGCT, and cuts between A and G. Cut the following DNA:
GCTTAGCTTGACAGCTAGCT
How many fragments are there?
1
2
3
4
Who's yo daddy?!
Dad 1
Dad 2
Dad 3
None of the dads
A roan cow shows co-dominance in fur color (orange & white). What is the phenotype ratio expected if a roan cow and a roan steer mate together?
4: Orange and White
1: Orange : 1 White
2 Orange: 2 Orange and White: 0 White
1: Orange: 2 Orange and White: 1 White
Orange or black fur is a single, X-linked, co-dominant trait in cats. Calico cats have white fur with patches of orange and black. Is it true that calico cats can only be female?
Yes, because they have 2 'X' chromosomes, and therefore can have both the orange and black alleles (XOXB)
No, males can be calico because they can have both the alleles for orange and black (XOYB)
Yes because the trait is found on the X chromosome (XOBX)
No, males can be calico because the trait is found on the X chromosome (XOBY)
Bob is blood Type B and Hilda is Type A, their son Barry is Type O. What are the only possible genotypes of Bob and Hilda?
Bob: IBi
Hilda: IAi
Bob: IBi
Hilda: IAIA
Bob: IBIB
Hilda: IAi
Bob: IBIA
Hilda: IAi
If hemophilia is a sex-linked recessive trait, what genotype would individual III-3 have?
XhX
XhXh
XhYh
XhY
