WorksheetsPart D Question on 4 LE state labs
Total questions: 144
Worksheet time: 2hrs 18mins
The size, shape, and green color of this insect are adaptations that would most likely help the insect to
The four different types of beaks shown are most likely the result of
biology.
Several of the Galapagos Islands are inhabited by grasshoppers, beetles, flies, bees, and butterflies. Finches that feed on these consumers would have beaks adapted for
Which two finches would compete the least for food?
Which factor most directly influenced the evolution of the diverse types of beaks of these finches?
The diversity of species seen on the Galapagos Islands is mostly due to
Identify the cellular structure that diffusion occurs across.
ribosome
mitochondria
cytoplasm
cell membrane
chloroplast
Describe diffusion:
the movement of molecules higher concentration to an area of lower concentration
the synthesis of molecules higher concentration to an area of lower concentration
the movement of molecules lower concentration to an area of higher concentration
the synthesis of molecules lower concentration to an area of higher concentration
Identify the substance/molecule that will not diffuse.
Starch
Glucose
Iodine
Identify the substance(s)/molecule(s) that will diffuse.
Starch
Glucose
Iodine
Identify the substance that was added to the outside of the plant cells that caused the change observed.
salt water
fresh water
distilled water
glucose
Identify which molecule is diffusing into the cell.
A
B
Molecule A cannot diffuse. What is a possible reason why?
Molecule A is a macromolecule and it is too large to move.
Molecule A is a building block and it is too large to move.
Molecule A is a building block and it is too small to move.
Molecule A is a macromole and it is too small to move.
Which choice accurately describes what happened in steps A and B?
Step A added saltwater so the water diffused out. Step B added freshwater so water diffused in.
Step A added saltwater so the water diffused in. Step B added freshwater so water diffused out.
Step A added freshwater so the water diffused in. Step B added saltwater so water diffused out.
Step A added freshwater so the water diffused out. Step B added saltwater so water diffused in.
What is the starch indicator?
Iodine
Bromothymol Blue
Benedict's Solution
Glucose
When iodine/starch indicator solution comes in contact with starch, which color change results?
amber to blue-black
blue to yellow/orange/brown
amber to blue
blue to amber
In our diffusion lab, what happened to the “cell” that contained starch solution after 20 minutes?
The contents of the dialysis tube turned blue-black.
The liquid in the beaker would turn blue-black.
The dialysis tube would burst.
There would be no change.
When a cell shrinks in size, what type of solution was added to it?
Salt solution
Tap water
distilled water
iodine solution
Cell membranes are said to be selectively permeable. Which statement best explains what selectively permeable means?
The cell membrane prevents any harmful substance from entering the cell.
The cell membrane lets certain substances enter the cell and keeps certain substances out of the cell.
The cell membrane allows only large molecules to diffuse into the cell.
The cell membrane has pores that let only water and glucose into the cell and carbon dioxide out.
What is the building blocks of starch?
glucose
fatty acids
lipids
amino acids
After 24 hours, where will starch be found in this experiment?
outside the cell, only
outside and inside the cell
inside the cell, only
After 24 hours, where will glucose be found in this experiment?
inside the cell, only
outside the cell, only
both inside and outside the cell.
The diagram below represents what occurred when an onion cell and a red blood cell were placed in distilled water. The best explanation for why the onion cells do not burst, while red blood cells often do, is that
the red blood cells have only a cell membrane, which does not protect them from bursting
the onion cells do not have a cell wall that could protect them from bursting
the onion cells have a cell membrane, which can protect them from bursting
the red blood cells have a cell wall, which does not protect them from bursting
A model cell is 95% water and 5% salt. It is placed into a beaker with a solution. After 20 minute the mass of the model cell has increased from 40 to 45 grams. What solution could the cell have been put in?
95% water and 5% salt
99% water and 1% salt
90% water and 10% salt
True or false: When a red onion cell is placed in a salt solution, the salt diffuses.
TRUE, salt diffuses through the membrane.
FALSE, water diffuses out of the cell, salt does not diffuse in the lab.
Which laboratory technique is shown in the diagram?
testing a specimen for amino acids
determining the pH of a specimen
measuring the photosynthetic rate in a specimen
preparing a wet mount slide of a specimen
An investigation is carried out to determine the effect of exercise on the rate at which a person can squeeze a clothespin.
In this investigation, the independent variable is the
control
exercise
rate of squeezing
number of participants
An investigation is carried out to determine the effect of exercise on the rate at which a person can squeeze a clothespin.
Muscle fatigue occurs during this activity when
carbon dioxide is used up in the muscle cells
simple sugar is converted to starch in the muscle cells
proteins accumulate in mitochondria in the muscle cells
certain waste products collect in the muscle cells
An investigation is carried out to determine the effect of exercise on the rate at which a person can squeeze a clothespin.
The experimental results could be made more valid by
increasing the number of students
using safety precautions
using a plastic clothespin
making a bar graph of the data
An investigation is carried out to determine the effect of exercise on the rate at which a person can squeeze a clothespin.
The dependent variable for this experiment is the
time the student was squeezing the clothespin
number of times the student was able to squeeze the clothespin
strength of the student
length of the clothespin
A student lifted weights after school and found that his muscles started to burn. He couldn’t continue to lift the weights after prolonged exercising. This muscle fatigue is most likely due to
the heart beating too fast and tiring out
the lungs accumulating oxygen
lack of oxygen and build up of waste in the muscles
lack of carbon dioxide in the muscles
A student hypothesized that watching sports on television would cause viewers’ pulse rates to increase. She designed an experiment to determine the effect of watching sports on pulse rate. A group of 200 volunteers took their pulse rates and then watched their favorite sports on television. After the games, they immediately took their pulse rates again. The data collected showed that the pulse rates of some people increased, but the pulse rates of an equal number of people did not change. Although the hypothesis was not supported by the data, the hypothesis is still valuable because it
may lead to further investigation
can be changed to fit the data
is the opinion of the experimenter
is based on beliefs of the volunteers
If a control group is not included in an experiment, it would be difficult to
formulate a hypothesis for the experiment
make observations about the experimental group
record data in a data table
draw a valid conclusion
An experiment was conducted to determine the effect of activity on pulse rate. Data were collected and recorded in the table shown.
Which activity most likely corresponds to the pulse rate of the person while sleeping?
1
2
3
4
Students were asked to design a lab that investigated the relationship between exercise and heart rate. Heart rate was determined by recording the pulse rate in beats per minute. The students hypothesized that increased exercise results in an increased heart rate. The class results for the experiment are shown in the graph.
Which statement is best supported by the graph?
Before exercising, the average pulse rate was 65; four minutes after exercising, the average pulse rate was 65.
After four minutes of exercising, the average pulse rate was 120; two minutes after exercising, the average pulse rate was 120.
While exercising, the highest average pulse rate was 150; before exercising, the average pulse rate was 65.
Two minutes before exercising, the average pulse rate was 80; after two minutes of exercise, the average pulse rate was 140
Students were asked to design a lab that investigated the relationship between exercise and heart rate. Heart rate was determined by recording the pulse rate in beats per minute. The students hypothesized that increased exercise results in an increased heart rate. The class results for the experiment are shown in the graph.
Students in a different science class carried out the same experiment. The data they obtained did not support the hypothesis that increased exercise results in increased heart rate. The most scientifically sound way to deal with this situation is to
write a new hypothesis
read about pulse rate in a biology textbook
have the students in both classes vote to decide which hypothesis is correct
ask students in a third class to do the experiment and see if their results support the hypothesis
A class is recording pulse rates of the students in a data table like the one shown.
One student checks his pulse and counts 23 beats over a time interval of 20 seconds. In which row in the data table should the pulse rate of this student be recorded?
A
B
C
D
Excretory
Which part is colored in the picture? (Look closely--it's the little dots!)
Nucleus
Mitochondria
Vacuole
Ribosomes
The part of the experiment that remains unaffected by the independent variable. Used to compare dependent variable to.
constants
control group
independent
dependent
A student is opening and closing clothespins as part of a lab activity. The student begins to experience muscle fatigue, and the rate at which the student is opening and closing the clothespins slows. Which graph best represents the relationship between time and number of clothespin squeezes?
1
2
3
4
What is the correct equation for cellular respiration?
(C6H12O6 is glucose)
6O2 + C6H12O6 -> 6CO2 + 6H2O + ATP
6O2 + C6H12O6 + ATP -> 6CO2 + 6H2O
6CO2 + 6H2O -> 6O2 + C6H12O6 + ATP
6CO2 + 6H2O + ATP -> 6O2 + C6H12O6
In an effort to determine how closely related several plant species are, a student performed the laboratory test in the diagram. The method used by the student to compare plant extracts from the different species is
Gel electrophoresis
DNA banding
A staining technique
Paper chromatography
When provided with a sequence of bases in one segment of mRNA, the Universal Genetic Code Chart is used to
Directly identify the DNA from an animal cell
Determine the sequence of amino acids in a protein
Change the RNA sequence of a protein into DNA
Identify the specific mutations in the genetic material in a cell
In many parts of the world, plants are used as a source of medicine. Many of these plants are in danger of becoming extinct. It is therefore important for researchers to
Collect and dry all the medicinal plants to preserve them for future use
Search for other plant species that could be used as a new source of that medicine
Use the plants now while we still have them
Apply fertilizer to reduce the numbers of the plant that grow in the wild
The fragments of DNA separated into these bands because of their
pH and color
charge and radioacitivity
electrical charge and size
color and size
The base pairs for DNA are
A-T
T-C
G-C
A-U
C-G
G-U
T-A
A-T
T-A
A-T
C-G
G-C
A-U
T-A
C-G
G-C
Which data is not molecular data?
DNA
Enzymes
Amino Acid Sequence
Flower shape
An enzyme cuts between CC and GG. Given the sequence
ATTCCGGATCATTTCCGGAAGC, how many pieces of DNA will be present on the gel?
1
2
3
4
The cell organelle that synthesize proteins is
ribosome
cell membrane
cytoplasm
nucleus
A DNA codon ATG would send an mRNA message of
CAT
TAC
UAC
GCA
Proteins are made of
nucleotides
base pairs
amino acids
all of these
Paper chromatography
separates molecules by size
uses electricity to separate molecules
is a structural observation
all of these
Enzymes are
proteins
coded by DNA
important in an organisms metabolism
all of these
Which chemicals are used to cut DNA into fragments for a gel electrophoresis procedure?
molecular bases
restriction enzymes
hormones
ATP molecules
A laboratory setup that can be used to provide information about relationships between four plant species is represented in the picture shown. This setup is part of the technique known as
electrophoresis
biological staining
dissection
chromatograph

Protein sequences in one organism that resemble those of another suggest a
coincidence
lack of evolutionary relationship
great number of mutations
shared common ancestor
According to this cladogram, which organism is least related to primates?
Rabbits
Birds
Crocodiles
Sharks
Which evidence should receive the most emphasis when determining the relatedness?
genetic sequence
the presence of an enzyme
plant pigments
structural characteristics of the stems
What is the purpose of gel electrophoresis?
helps cut DNA
count the genes in DNA
separates DNA based on size
allows for an exact replicated organism
What human activities could cause Botana curus to become extinct? (Choose all that apply)
destruction of natural habitat
pollution
introduction of foreign species that compete with native species
removal of predators
planting more Botana curus
Which organic molecule is an enzyme?
carbohydrate
fat
protein
nucleic acid
Stem cross sections were studied in this lab. What structures were compared?
arrangement of vascular bundles
storage vacuoles
length of stems
plant cell nuclei
Which two living species would be expected to have the most similar proteins?
A and C
B and C
E and F
H and M
Compared to the fragments at the top of the gel, the fragments at the lower end are
smaller, and move faster
larger, and move faster
smaller, and move slower
larger, and move slower
Which chemicals are used to cut DNA into fragments for a gel electrophoresis procedure?
ATP molecules
enzymes
molecular bases
hormones
The process shown in the given diagram represents
protein synthesis
gene recombination
cellular respiration
cellular reorganization
Structure X in the given diagram represents a
vacuole
ribosome
nucleus
mitochondrion
Base your answer to the following question on the chart below and on your knowledge of biology.
Which evolutionary tree best represents the information in the chart?
Cytochrome c is an enzyme located in the mitochondria of many types of cells. The number of differences in the amino acid sequences of Cytochrome c from different species are compared to human Cytochrome c in the data table below.
Cytochrome c is most likely a
protein molecule
material containing genes
carbohydrate that is absorbed by cells
component of the membrane around the cell
The diagram below represents a laboratory apparatus.
This apparatus is used to
identify the molecular bases in DNA
detect chemical toxins in the air
stain specimens before observing them with a microscope
separate a mixture of plant pigments
Base your answer to the following question on the chart below and on your knowledge of biology.
Which evolutionary tree best represents the information in the chart?
Paper chromatography is a laboratory technique that is used to
separate different molecules from one another
stain cell organelles
indicate the pH of a substance
compare relative cell size
In preparation for an electrophoresis procedure, enzymes are added to DNA in order to
convert the DNA into gel
cut the DNA into fragments
change the color of the DNA
produce longer sections of DN
Cytochrome c is an enzyme located in the mitochondria of many types of cells. The number of differences in the amino acid sequences of Cytochrome c from different species are compared to human Cytochrome c in the data table below.
Cytochrome c is most likely a
protein molecule
material containing genes
carbohydrate that is absorbed by cells
component of the membrane around the cell
This laboratory technique is known as
gel electrophoresis
DNA replication
protein synthesis
genetic recombination
This technique used to analyze DNA directly results in
synthesizing large fragments of DNA
separating DNA fragments on the basis of size
producing genetically engineered DNA molecules
removing the larger DNA fragments from the samples
To demonstrate techniques used in DNA analysis, a student was given two paper strip samples of DNA. The two DNA samples are shown below.
Sample 1: ATTCCGGTAATCCCGTAATGCCGGATAATACTCCGGTAATATC
Sample 2: ATTCCGGTAATCCCGTAATGCCGGATAATACTCCGGTAATATC
The student cut between the C and G in each of the bolded CCGG sequences in sample 1 and between the As in each of the bolded TAAT sequences in sample 2. Both sets of fragments were then arranged on a paper model of a gel.
The results of this type of DNA analysis are often used to help determine
the number of DNA molecules in an organism
if two species are closely related
the number of mRNA molecules in DNA
if two organisms contain carbohydrate molecules
Scientists hypothesize that cabbage, broccoli, cauliflower, and radishes developed along a common evolutionary pathway. Which observation would best support this hypothesis?
Fossils of these plants were found in the same rock layer.
Fossils of these plants were found in the same rock layer.
These plants live in the same environment.
These plants have similar proteins.
The diagram below shows the results of a test that was done using DNA samples from three bears of different species. Each DNA sample was cut into fragments using a specific enzyme and placed in the wells as indicated below. The DNA fragments were then separated using gel electrophoresis.
Gel electrophoresis is used to separate DNA fragments on the basis of which property?
size
color
functions
chromosomes
The parents of a new baby believe they brought the wrong child home from the hospital. Gel electrophoresis was performed using DNA samples from the parents and the child. A section of the gel electrophoresis results is shown below.
Which conclusion is valid based on the gel electrophoresis results?
They have the correct child, because her genetic information is identical to that of the father.
They have the wrong child, because her genetic information does not match that of either parent.
They have the correct child, because her genetic information came from both parents.
They have the wrong child, because her genetic information matches only that of the mother.
Which technique could be used to separate pigments from a mixture?
preparing a wet-mount slide
staining
paper chromatography
dissection
Which branching tree diagram shows that species W and Z are most closely related?
Which technique could be used to determine the relative number of bases in fragments taken from a sample of DNA?
electrophoresis
cloning
paper chromatography
light microscope
The diagram shows the evolutionary relationships of some organisms.
Which two organisms would most likely synthesize the most similar enzymes?
monkey and mouse
cow and horse
chimp and rat
horse and dog
The diagram below represents the results of a laboratory procedure.
This procedure is used to
separate molecules in a liquid mixture
determine the rate of photosynthesis in plants
detect glucose in a solution
examine the gene sequences of organisms
A valuable medicine is obtained from a certain rare species of plant. Scientists are anxious to find another more abundant species of plant that is closely related to the rare one, and also produces the medicine.
Two newly discovered plant species, A and B, were studied and compared to the rare one. The results of the study are shown in the table below.
Which procedure could also be carried out to help determine which newly discovered species is most closely related to the rare species?
measurement of respiration rate in the plants
chromatography of pigment extracts from the plants
determination of the type of gas released by photosynthesis in the plants
analysis of chemical bonds present in glucose in the plant
A student added an enzyme to a test tube containing a sample of DNA. After a period of time, analysis of the DNA sample indicated it was now broken into three segments. The purpose of the enzyme was most likely to
cut the DNA at a specific location
move the DNA to a different organism
copy the DNA for protein synthesis
alter the DNA sequence in the segment
Which three codons would code for a different amino acid sequence from that coded for by the mRNA base sequence AGU-UCA-CCA?
AGC-UCU-CCU
AGU-UCC-CCG
ACC-UCA-CUU
AGU-UCG-CCC
A human gene contains the following DNA base sequence: ACGCCCACCTTA
The gene mutated. It then contained the following DNA base sequence: ACGCGCACCTTA
Which type of mutation is represented in the new gene?
addition
deletion
inversion
substitution
Scientists recently discovered that three different types of squid, a marine animal, previously thought to be three different species, were actually all members of one species. Their earlier ideas were based on using squid carcasses (dead bodies). The new, more accepted classification is most probably based on an analysis of
a greater number of squid carcasses
the feeding habits of the three different species
a number of newly found squid fossils
the DNA present in the cells of squid
The diagram below represents evolutionary pathways of seven groups of organisms alive today.
Which two living species would be expected to have the most similar proteins?
A and B
B and C
E and F
H and M
Paper chromatography is a method used in
comparing the shapes of plant leaves
separating mixtures of plant pigments
comparing habitats of different plants
separating individual DNA fragments of plants
Structure X is a
mitochondrion
vacuole
nucleus
ribosome
The process shown in the diagram is
cellular respiration
cellular reorganization
gene recombination
protein synthesis
Caretakers at a zoo are trying to determine which of two male tigers fathered the newest cub. They obtained DNA from the tiger cub, the mother tiger, and the two male tigers. The DNA was analyzed. The results of the analysis are shown below.
The technique used to separate the DNA for analysis is
genetic engineering
electrophoresis
chromatography
protein synthesis
A plant was discovered that contained a compound that was found to have potential medicinal value. However, the plant is rare, so it is important to see if a related plant might also produce the same compound. The chart shows some characteristics of the plant and four possible relatives.
Which plant in the chart would be selected as most similar to the medicinal plant?
A
B
C
D
Base your answer on the diagram below and on your knowledge of biology. The diagram represents the results of paper chromatography performed on extracts from five organisms.
Which two organisms are most closely related?
cyanobacteria and green algae
red algae and spinach
brown algae and red algae
red algae and cyanobacteria
The diagram below shows the evolutionary relationships among several types of mammals.
Which mammal would be most closely related to a hippopotamus?
deer
whale
pig
cow
Which chemicals are used to cut DNA into fragments for a gel electrophoresis procedure?
enzymes
molecular bases
hormones
ATP molecules
A laboratory setup that can be used to provide information about relationships between four plant species is represented below.
This setup is part of the technique known as
electrophoresis
biological staining
dissection
chromatograph
During the Relationships and Biodiversity lab, simulated pigments from three plant species were compared to those in Botana curus. The results were similar to those represented below.
Based on the results of this comparison alone, is there enough information to conclude which of the other three species is most closely related to Botana curus?
Yes. Only species X has the same bands as Botana curus.
Yes. Species Z has only two of the bands that Botana curus has.
No. Additional tests should be done to test for other chemical similarities.
No. Other rainforest plant species should be tested.
When provided with a sequence of bases in one segment of mRNA, the Universal Genetic Code Chart is used to
directly identify the DNA from an animal cell
determine the sequence of amino acids in a protein
change the RNA sequence of a protein into DNA
identify the specific mutations in the genetic material in a cell
A rare tropical plant was found to have medicinal properties. A search was conducted to find other plants that are closely related to the rare plant. Which combination of characteristics would best identify the plant most closely related to the original one?
shape of seeds, number of flower petals, leaf pigments
number of flower petals, positive reaction to a specific enzyme
leaf pigments, sequence of DNA bases, positive reaction to a specific enzyme
presence of DNA bases, internal stem structure, shape of seeds
A procedure used in paper chromatography is represented below:
The student is preparing two strips of paper for a chromatography activity. After adding a dot of the ink from the marker pen to the line on the paper on the right, the next step should be to place the strips in a beaker of solvent with the solvent level
between the bottom of the paper and the dot of ink
even with the dot of ink on the paper
just below the bottom edge of the paper
slightly above the dot of ink on the paper
The evolutionary tree below represents possible relationships between several species of plants.
In addition to analyzing DNA, what other evidence could be used to best support the evolutionary relationship between species B and C?
Species B and C live in the same ecosystem.
Species B and C require the same amount of sunlight.
Species B and C possess many of the same enzymes.
Species B and C grow to the same maximum height as species A.
When comparing characteristics of two organisms, which evidence would be considered the strongest for supporting a possible evolutionary relationship?
The two organisms are the same color.
The two organisms are the same height.
The two organisms produce many of the same proteins.
The two organisms are found in the same locations.
The amino acids bond together to form which type of complex molecule?
protein
starch
fat
sugar
The gel electrophoresis patterns for two species can be compared to reveal similarities and differences in
body structures
base sequences
gametes produced
nutrients required
The amino acid sequence of four species, Bc, X, Y, and Z, were compared to determine their evolutionary relationship. Based on the amino acid sequence below, identify the evolutionary tree that best represents the relationship between the species.
The diagram shows the evolutionary relationships of some organisms.
Which two organisms would most likely synthesize the most similar enzymes?
monkey and mouse
cow and horse
chimp and rat
horse and dog
A laboratory setup that can be used to provide information about relationships between four plant species is represented below.
This setup is part of the technique known as
electrophoresis
biological staining
dissection
chromatograph
The amino acid sequence of four species, Bc, X, Y, and Z, were compared to determine their evolutionary relationship. Based on the amino acid sequence below, identify the evolutionary tree that best represents the relationship between the species.
The amino acids bond together to form which type of complex molecule?
protein
starch
fat
sugar
