WorksheetsUnit 7 - Biotechnology Review
Total questions: 133
Worksheet time: 2hrs 50mins
Changing the genetic material of a living organism
Biotechnology
Crossbreeding
Selective Breeding
Genetic Modification (GM)
Produce an organism that is the exact copy of another
Gene Splicing
Genome
Cloning
Bioremediation
DNA is unique for everyone except
parents and child
siblings
identical twins
father and mother
In gel elctrophoresis
Dna travels from the positive to negative end
Dna travels from the negative to positive end
Dna travels based on the mass of the proteins present in it
Dna travels based on the promoter function at its binding site
In transformation experiments....
plasmid is trapped via the heat shock
single stranded dna is trapped via the heat shock
the heat shock is used to denature dna
recombinant dna can be produced
Which best describes stem cells?
stem cells can only come from embryos
stem cells can only come from adult bone marrow
stem cells do not ever change
stem cells can develop into different specialized cells that could be used to treat diseases or injuries
This diagram represents which of the following processes?
Gel electrophoresis
Gene therapy
Cloning
Genetic engineering
If a restriction enzyme, ECORI, cuts the DNA at the restriction site G/AATTC, which DNA sequence below would this enzyme cut?
TTAACGCGAATTCGG
AATTGCGCTTAAGCC
TTCCAAGGATCGCCC
AAGGTTCCTAGCGGG
Which of the following is not a use of biotechnology?
Mating two dogs together to produce a desired result (ex. Golden Doodle puppy)
Injecting stem cells into a patient to help with injury recovery.
Growing an ear in a lab to use for transplant.
Identifying the father of a child in a paternity suit.
1. Remove nucleus from adult somatic cell to be cloned.
2. Remove nucleus from donor egg.
3. Impregnate surrogate with modified egg.
4. Implant desired nucleus into donor egg.
____ is an application of biotechnology that involves the insertion of normal genes into cells with defective genes in order to correct genetic disorders.
gene gun
gene mapping
gene linkage
gene therapy
Genetic information of a species
GMO
Hybrid
Genetics
Genome
The direct manipulation of an organisms genes
GMO
Genetics
Genetic Modification
Genome
The part of biotechnology that uses enzymes to produce chemicals, plastics and paper
Agriculture
Hydrosphere
Medicine
Industrial
Which is true of the field of biotechnology?
It includes only studies related to genetics and genetic engineering
It involves the manipulation of living organisms for human well being
It is only useful in agriculture in the production of plants
It is illegal in much of the world, including Europe
DNA paternity tests are a biotechnology technique used in the selective breeding of livestock to insure that:
a particular offspring is from a specific set of parents
a particular offspring expresses a particular genetic trait
livestock are receiving the proper nutrition requirements for growth
livestock have no genetic disorders that would lesson their value
Concerns over recent outbreaks of infectious diseases in livestock and increasing fear of bioterrorism has prompted many agricultural production facilities to:
begin importing cattle from the United Kingdom
install biological barriers limiting the introduction of microorganisms
stop exporting livestock to other states and countries
test every beef steer slaughtered for mad cow disease.
The process through which scientists isolate and remove genes coding for a specific trait from one organism for insertion into the DNA sequence of other organisms is:
cross breeding
DNA analysis
electrophoresis
genetic engineering
The method of reproduction resulting in a genetically identical offspring is:
artificial insemination
asexual reproduction
grafting
sexual reproduction
Combining horticulture, animal science, and medicine in an attempt to create plants and animals that produce compounds needed in medicine is best known as
biological medicine
mediculture
microbiology
pharming
Rapid improvements in the genetics of many livestock breeds in recent years is most likely:
a result of increased use of biotechnology applications including in vitro fertilization and artificial insemination.
a result of increased isolation of breeds and individual animals in small agricultural markets.
a serious problem for producers, as better animals are more costly to purchase and care for.
attributable to the formation of purebred associations founded in the 1990’s to encourage better breeding management.
Inbreeding several generations of a plant or animal species to isolate a specific beneficial gene is one step in the process of:
cloning
hybridization
in vitro fertilization
selective breeding
Compared to animals, selective breeding in plants:
is usually accomplished much quicker with a higher rate of success.
is usually more difficult and has had little impact in horticulture.
is utilized much less frequently in agriculture.
may be easily accomplished without worry of natural fertilization.
In addition to a good genetic background, which is most important for parent plants or animals used in the breeding program?
both parents express the same desirable traits
both parents share a common ancestor
each parent is healthy
hybrid animals are used
Misty uses a chemical compound to break down proteins in the DNA sample. She ismost likely using:
cellulose.
ethanol.
fructose.
protease.
The use of cloned animals to increase the number of organisms in an endangered population is seen as dangerous by many scientists who think the practice will:
disrupt genetic diversity that occurs through natural reproduction in the population.
increase the number of organisms in the population too rapidly.
magnify the spread of bacterial diseases.
result in an overabundance of genetic diversity in the population.
According to recent studies, the use of Bt crops and other transgenic plants in the United States has helped farmers to decrease:
dependence on ecologically harmful biological controls.
pesticide use by more than 46 million pounds.
the amount of fertilizers used by nearly 50%.
time required to grow vegetables by 25%.
What is transformation?
The use of viruses to transform or genetically
engineer cells.
The measure of how well cells are transformed in a new phenotype.
The insertion of a foreign plasmid into a bacterial cell which results in new acquired traits.
Genetic engineering or transformation of mammalian cells.
ACTCAGTCCTCTAAGCCAGTCCTCAAAAGTC
How many fragments are there?
Select the sizes of the fragments created by an EcoRI digestion
28
10
14
16
18
Select the sizes of the fragments made when this DNA is cut by by XbaII
6
12
18
20
38
A company that creates hair dye would most likely employ a bio-technician for which job?
researching trends
developing new colors
creating cost effective packaging
developing a product that will be safe for consumers
Which are most closely related to biotechnology?
medicine and agriculture
construction and engineering
water treatment and electricity generation
communication and information technology
Which is a concern of scientists when genetically modifying plants?
Plants will pass on diseases to animals.
There will be a decrease in biodiversity.
Plants will have a longer growing season.
There will be a decrease in revenue for pesticide manufacturers.
Which best describes a controversial issue associated with the use of genetically modified crops?
the use of genetically modified crops to increase potential yield
the short term use of genetically modified crops in famine stricken countries
the development of genetically modified crops which are resistant to herbicides
the long term effects which may arise from the use of genetically modified crops
Bacteria cells can be used to produce insulin for the treatment of diabetes in humans. Which best explains how the bacteria cells are able to produce insulin for humans?
The bacteria have been grown on a petri dish containing insulin.
The bacteria have been genetically engineered to contain the DNA needed to produce insulin.
The bacteria have been exposed to radioactivity to create mutant strains capable of producing insulin.
The bacteria have been grown on a petri dish containing sugar; the bacteria produce insulin in response to the sugar.
Which area of biotechnology would most likely create ethical issues within human society?
insulin production by bacteria
organ cloning for use in transplants
genetic engineering to improve agricultural yields
DNA and forensic testing of crime scene evidence
Which is most important when investigating ethical issues in biotechnology?
cost of the technology
advantage of the technology
public opinion of the technology
benefits of the technology outweighing the harm
Genetic engineering has directly increased productivity in which U.S. industry?
agriculture
automobile
media
none of the above
Personal medical records become more available and more detailed because of biotechnological research. Based on this information, which is a major concern to the public?
transmission of more diseases
an increase in under qualified doctors
inappropriate use of medical information
overdiagnosis of certain medical conditions
Which is a genetic engineering advancement directly related to a career in biotechnology?
improving solar energy collection
transporting textiles at higher rates
creating crop foods that resist insect pests
repairing historical sites with quality materials
Which would be reduced as a result of the development of pest-resistant crops?
use of organic fertilizers
use of chemical insecticides
practice of crop rotation techniques
practice of hydroponic farming techniques
7) What types of diseases are plasma-based medicines (gene therapy) used to treat?
Viral Infections
Bacterial Infections
Fungal Disease
Genetic diseases
8) Scientists implant a gene into a species of tomato plant that makes them ripen faster and stay firm as they are transported to stores. What is the benefit of this technology?
Increased toxins in the food.
Increase shelf life and availablity.
Decreased size of tomatoes.
Increased seed production
11) What is gene therapy?
Using radiation to fix genes.
Using a modified virus to fix genes.
12) What would be a negative side of genetically modified foods?
Lower cost of production.
Long-term health effects, such as possible allergies to proteins not found in foods before GMO’s.
Ability to produce more food in less time.
Ability to grow more nutritious food in less time.
14) What have scientists been able to do as a result of mapping the human genome?
Create medicines to fight HIV.
Engineer genes to eliminate cancers.
Identify genes linked with genetic disorders.
18) What would be a direct benefit of biotechnology to agriculture in a time of severe drought?
Planting crops in shaded areas.
Genetically modifying crops to be resistant to changes in weather
Harvesting crops to have thick stems and leaves.
Issues that refer to people’s moral values or the code of conduct by which they live
Social issues
Legal issues
Cultural issues
Ethical issues
Which of the following involves ethics?
Passing a law to allow more crops to be grown per acre in a given area.
Passing a law to allow doctors to euthanize humans who are terminally ill.
Passing a law to increase fines for people texting while driving.
Passing a law to decrease speed limits in an area of frequent accidents.
Stem cells from a donor are cultured and then implanted into a person with Alzheimer’s disease. Why is this procedure most likely considered controversial?
There are associated ethical and moral issues.
There is an insufficient supply of donor cells.
There is an increased risk of infection.
The patient did not give consent.
Which situation is most likely to raise ethical questions about using biotechnology?
increased crop yields
new vaccine development
increased job opportunities
genetically modified food crops
Which process uses a body cell to create a new organism?
crossbreeding
cloning
genetic modification
gene splicing
SELECT ALL THAT APPLY: Which of the following best describes "stem cells?"
A cell without a job
A cell with a specific job in your body
A cell that can turn into ANY type of cell in your body
A cell that has procured a viral infection
Which of the following might scientists use gel electrophoresis for?
Solve crimes
Edit diseased genes
Replace diseased cells
Identify fathers
Determine how related 2 species are
